Hi Guys
I am using soap aligner on fastaq files and I get a "segmentation fault" at the end of the process. The input files have been created by myself with a script that extracted the reads from an old alignment file and, for this reason I suspect that there may be some problem with them although at a first sight they look ok. The command I used is inside a file called "go" and is the following
I get the following output:
the last lines of my input files are
It looks everything right to me...... any idea?
thanks a lot for helping
I am using soap aligner on fastaq files and I get a "segmentation fault" at the end of the process. The input files have been created by myself with a script that extracted the reads from an old alignment file and, for this reason I suspect that there may be some problem with them although at a first sight they look ok. The command I used is inside a file called "go" and is the following
Code:
./soap -D ./index/genome.fasta.index -a exp_47_s_A1.fastq -b exp_47_s_A2.fastq -o paired_mapped_v2g3r1_1 -u unpaired_v2g3r1_1 -2 single_mapped_v2g3r1_1 -v 2 -g 3 -m 50 -x 400 -r 1 -t -p 14
I get the following output:
Code:
Begin Program SOAPaligner/soap2 Wed Sep 29 15:34:14 2010 Reference: ./index/genome.fasta.index Query File a: exp_47_s_A1.fastq Query File b: exp_47_s_A2.fastq Output File: paired_mapped_v2g3r1_1 single_mapped_v2g3r1_1 unpaired_v2g3r1_1 Load Index Table ... lsLoad Index Table OK Begin Alignment ... 131072 ok 3.36 sec .................................. .................................. 24510464 ok 3.96 sec 24641536 ok 3.73 sec 24772608 ok 3.79 sec 24903680 ok 3.63 sec 25034752 ok 3.86 sec ./go: line 1: 25344 Segmentation fault
Code:
tail exp_47_s_A1.fastq +ILLUMINA-C3C24B_0047:1:120:18879:21119#0/1 abb\bb_]__]]]]]KKDOOWZWWWbbabbbbbbbbbbbbb_bbbOODDOOONNNb\bbba`]Xa`Ya^``_[bb @ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1 agcagatcatgtggtganggactcggctggtcacagtcaggctgtgagccgatggtttgcccctcccccagggat +ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1 bbbbbbbbbbbbbbb``F^`aaaaabbbbb_ba`baab_a``_`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB @ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1 CTTGAAAACCTAGAATCAACACAAAATGAAAAAAAAAAAAAGCCCAAAAAAATGGCTTCCAAACCAGAAAactga +ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1 bbbbbbbbbbbbabbbabb_bbbbbbbbbbbbbb______ZL_[]`_`__b]Y\`]\\`O^]]W^bVb]bBBBBB tail exp_47_s_A2.fastq +ILLUMINA-C3C24B_0047:1:120:18879:21119#0/2 bb^bbbbbbbabbbbS^W[^bbb_bbbbbbVUFZVOIKKO[ZVXWLTWWTT^^^[]RRR__BBBBBBBBBBBBBB @ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2 GTATTATCTACTGTGAGAGGAGTTGAGATCCGATTGAGTCCCGAGAGTATCTgtcgcattctcgacatcccttcg +ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2 bbbbbbbbbbbbbbbbbbbbbbbbb_bbbbabbbbbbbc`c__ababab^U^BBBBBBBBBBBBBBBBBBBBBBB @ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2 CAAATATGCAGCTCAAATGTCATCCCTGCATGCTCTAATACCAATTGATGAACTTTTAaacgacataggatcaca +ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2 bbbbb`bbbbbbbbbbbbb_bbbbbbbbbb_b^]b`abb^bbb`aaa`^`aaU]^^a_BBBBBBBBBBBBBBBBB
It looks everything right to me...... any idea?
thanks a lot for helping
Comment