SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bubbles in R1 only (NextSeq500) Chris Coldren Illumina/Solexa 1 11-08-2018 07:47 AM
NextSeq500 early results HMorrison Illumina/Solexa 6 07-22-2015 01:29 PM
nextSeq500 heat output RemitoAmigo Illumina/Solexa 1 06-04-2015 11:03 AM
bcl2fastq output quality of index ezseq123 Bioinformatics 5 04-29-2015 11:42 PM
Nextseq500 N's from position 25 Asaf Illumina/Solexa 2 02-23-2015 01:52 AM

Reply
 
Thread Tools
Old 04-16-2019, 04:52 AM   #1
cmccabe
Senior Member
 
Location: chicago

Join Date: Jul 2012
Posts: 353
Default Nextseq500 output from bcl2fastq 2.20

After bcl2fastq the below is what my first two lines of R1 and R2 look like. Being new to Illumina data I don't think it looks right and wanted to confirm. Thank you .

R1
Code:
@NB551591:5:HN575BGX7:1:11101:5998:1036 1:N:0:TCCGTCTA
GCTTTNCTCCCGCCCCTGTGGCTCCCACATGCTGAGTTGAGNTTGGAAGCCCGTGGGTCTGGGCAGCTTCATCGGGCCGTGCGTCCAGCAGGCCTGAGTGTCCAGCCCACCCTGGTACCCANCTTTCTGAATCACCAGACTTTATCATCAG
+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEAEEEEEEEEEEEA#EAEEAEEAAEEEEEEEAEEEEAEAAEAE<
@NB551591:5:HN575BGX7:1:11101:16701:1039 1:N:0:TCCGTCTA
GCCCGNCCGCCTGCCTCACCTCACACTCGCGGCTCAGCTTCCTAAAAAACTCCTCGTTCTCGAACTTGCTTCTCTGGTCGGGCACGACGCGCGGCATCTTCCCGCCCTGAGGCCGCGCCGGCCGGCCGCGCTCGGGGCTTGCGCGGGCAC
+
AAAAA#EEEEEEEEEEEEEEEE6EEEEEEEEEEEEEEE/EAEEEEEEEEEEAAEEEAEAEEEE6EEEEEEEEEEEEAEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEE/EEEAEEEEEEEEEEEE/E
R2
Code:
@NB551591:5:HN575BGX7:1:11101:5998:1036 2:N:0:TCCGTCTA
CAGCCTGTANAANCNTNNNNNNNNNNNNCNNNNANNANNNNNNNNNGNNCGGACNCNTNTNNCNCNNNCNNCNNANNNCNTNNGNCCCNNTNAGGCNNGNNCCACNNNCNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
AAAAAEEEA#EE#E#E############E####A##E#########E##EEEEE#E#E#E##E#E###E##E##A###E#E##E#EAE##E#EEEE##E##EEAE###E#####E####################################
@NB551591:5:HN575BGX7:1:11101:16701:1039 2:N:0:TCCGTCTA
CGCCGCGGGTGGGCNGNNNNNNNNTCANCNNGGAGCCNNCCNNNNGGNNCCCGCNCNANCNNCNANNNCNNCNNGNNGGNGCGGNCTCNNGGCGGGANGNTGCCGNNCGNNNNGCNNNNNNNNNGNNNNNNNNNNNNNNNNGNNGANNNNN
+
AAAAAEEEEEEEEE#E########EEE#E##EEEEEE##EE####EE##EEEEE#E#A#E##E#E###E##E##E##EE#EEEE#EEE##EEEEEEA#E#EEEEE##EE####EE#########/################<##EE#####
@NB551591:5:HN575BGX7:1:11101:6608:1039 2:N:0:TCCGTCTA
TGAGATCCACTATANTNNNNNNNNGTTNANNATTTCANNATNNNTTANNGAGCAATNGNCNNCNGNNNTNNTNNANNGANAAAGNTCGNNAGAGCGTNGNGTAGGNNAANNNNGTNNNNCNNNNTNNNNNNNGNNNNNNNNANNAANNNNN
+
AAAAAEEEEEEEEE#E########EEE#E##E/EEEE##EE###EEE##EEEEEEE#E#E##A#/###E##<##E##AE#EEEA#EEA##EEEEEEA#E#A/EAE##<E####/A####/####/#######/########A##EE#####
cmccabe is offline   Reply With Quote
Old 04-16-2019, 05:39 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,924
Default

Format of the data looks fine.

First few reads generally have N's so I would not worry about that part. Hopefully rest of the data is of good quality.
GenoMax is offline   Reply With Quote
Reply

Tags
bcl2fastq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:32 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO