Hi all,
When counting for stranded RNAseq reads on an annotated BAC-sequence, i get no counts for my features although the features show tons of reads aligned to it in IGV.
I checked if those were all multimapped reads, but there are actually also a lot of uniq alignments (NH:i:1).
Do you know how to solve this?
Reads were aligned using tophat2 and counted with following options:
The output i get from htseq-count:
748 GFF lines processed.
246143 sam line pairs processed.
augustus_masked-bac2_383_131865-processed-gene-0.19 0
maker-bac2_383_131865-augustus-gene-0.20 0
maker-bac2_383_131865-augustus-gene-0.21 0
no_feature 124646
ambiguous 0
too_low_aQual 0
not_aligned 0
alignment_not_unique 121497
one of the features:
maker-bac2_383_131865-augustus-gene-0.20 has location at: bac2:383-131865 65171-70109
one of the unique aligned reads which should produce a count:
----------------------
Read name = OBIWAN:33276GACXX:8:1106:19961:7833
Location = bac2:383-131865:65,654
Alignment start = 65,610 (+)
Cigar = 51M
Mapped = yes
Mapping quality = 50
----------------------
Base = G
Base phred quality = 37
----------------------
Pair start = bac2:383-131865:65737 (-)
Pair is mapped = yes
Insert size = 178
Pair orientation = F2R1
----------------------
Second in pair
-------------------
MD = 51
XG = 0
NH = 1
NM = 0
XM = 0
XN = 0
XO = 0
AS = 0
YT = UU
-------------------
Alignment start position = bac2:383-131865:65610
TGAGAACAAGATGGTGAAGCTCATAGCTGATGCTAGCAAAGAGTGGGGGAT
Thank you, Michel
When counting for stranded RNAseq reads on an annotated BAC-sequence, i get no counts for my features although the features show tons of reads aligned to it in IGV.
I checked if those were all multimapped reads, but there are actually also a lot of uniq alignments (NH:i:1).
Do you know how to solve this?
Reads were aligned using tophat2 and counted with following options:
Code:
htseq-count -m union -s reverse -i ID -t gene RNAseq2013-1-htseq-sorted.sam ../../BAC-Annotation/pure-bac2.gff
748 GFF lines processed.
246143 sam line pairs processed.
augustus_masked-bac2_383_131865-processed-gene-0.19 0
maker-bac2_383_131865-augustus-gene-0.20 0
maker-bac2_383_131865-augustus-gene-0.21 0
no_feature 124646
ambiguous 0
too_low_aQual 0
not_aligned 0
alignment_not_unique 121497
one of the features:
maker-bac2_383_131865-augustus-gene-0.20 has location at: bac2:383-131865 65171-70109
one of the unique aligned reads which should produce a count:
----------------------
Read name = OBIWAN:33276GACXX:8:1106:19961:7833
Location = bac2:383-131865:65,654
Alignment start = 65,610 (+)
Cigar = 51M
Mapped = yes
Mapping quality = 50
----------------------
Base = G
Base phred quality = 37
----------------------
Pair start = bac2:383-131865:65737 (-)
Pair is mapped = yes
Insert size = 178
Pair orientation = F2R1
----------------------
Second in pair
-------------------
MD = 51
XG = 0
NH = 1
NM = 0
XM = 0
XN = 0
XO = 0
AS = 0
YT = UU
-------------------
Alignment start position = bac2:383-131865:65610
TGAGAACAAGATGGTGAAGCTCATAGCTGATGCTAGCAAAGAGTGGGGGAT
Thank you, Michel
Comment