SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Adapter trimming figo1019 RNA Sequencing 2 07-17-2018 04:00 AM
Best adapter trimming? ronton Bioinformatics 12 08-21-2014 03:04 PM
Adapter trimming and trimming by quality question alisrpp Bioinformatics 5 04-08-2013 04:55 PM
3' Adapter Trimming caddymob Bioinformatics 0 05-27-2009 12:53 PM

Reply
 
Thread Tools
Old 10-03-2014, 05:02 AM   #1
Palgrave
Member
 
Location: norway

Join Date: Aug 2011
Posts: 73
Default adapter trimming miRNA sequencing

Below is the output from FastQC. Any idea what to trim for? Tried the Illumina Single End Adapter 1 but got no mapping. What are the A, and how do I get rid of them?


ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAA 4805262 44.91006094070466 Illumina Single End Adapter 1 (95% over 24bp)
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAA 1107781 10.353340196425243 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACA 200679 1.8755493705691118 No Hit
CGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA 144914 1.3543687256098158 Illumina PCR Primer Index 7 (96% over 29bp)
TAGCTTATCAGACTGATGTTGACATCTCGTATGCCG 140931 1.3171435394021074 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAACAA 124510 1.1636725921972906 No Hit
TGTAAACATCCTTGACTGGAAGCATCTCGTATGCCG 114871 1.0735863331322382 No Hit
TCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAA 112198 1.048604429357896 Illumina Single End Adapter 1 (100% over 21bp)
TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAA 110008 1.0281366518547872 Illumina Single End Adapter 1 (95% over 23bp)
ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAC 94442 0.8826565492915952 Illumina Single End Adapter 1 (95% over 24bp)
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAC 82271 0.7689061748667841 No Hit
TGAGGTAGTAGGTTGTATAGTTATCTCGTATGCCGT 77257 0.7220452450035024 No Hit
GTAGTGTTTCCTACTTTATGGAATCTCGTATGCCGT 62069 0.5800979369134498 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAAA 58659 0.5482280185181984 No Hit
Palgrave is offline   Reply With Quote
Old 10-03-2014, 05:56 AM   #2
amitm
Member
 
Location: Manchester, UK

Join Date: Feb 2011
Posts: 52
Default

Hi Palgrave,
Have you visited here -
http://support.illumina.com/download...ce-letter.html
The pdf file enlists all adapter sequences. If you copy the first entry in your list (without the polyA tail) and search in the pdf, you will see that its the TruSeq adapter.

I wouldn't bother about the polyA and just give the remaining sequence as a contaminant to any adapter trimmer tool. When the tool chops, the polyA's get removed too. I use Trimmomatic (can use multiple threads).
amitm is offline   Reply With Quote
Old 10-03-2014, 12:17 PM   #3
mgogol
Senior Member
 
Location: Kansas City

Join Date: Mar 2008
Posts: 197
Default

I've used trimmomatic with the adapters file that comes along with fastqc converted to a fasta file. Worked good. The As might be after it reads all the way through the adapter and isn't reading anything, maybe?
mgogol is offline   Reply With Quote
Old 10-03-2014, 08:51 PM   #4
relipmoc
Member
 
Location: Los Angeles, CA

Join Date: Jul 2011
Posts: 58
Default try skewer

Quote:
Originally Posted by Palgrave View Post
Below is the output from FastQC. Any idea what to trim for? Tried the Illumina Single End Adapter 1 but got no mapping. What are the A, and how do I get rid of them?


ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAA 4805262 44.91006094070466 Illumina Single End Adapter 1 (95% over 24bp)
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAA 1107781 10.353340196425243 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAACA 200679 1.8755493705691118 No Hit
CGATCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA 144914 1.3543687256098158 Illumina PCR Primer Index 7 (96% over 29bp)
TAGCTTATCAGACTGATGTTGACATCTCGTATGCCG 140931 1.3171435394021074 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAACAA 124510 1.1636725921972906 No Hit
TGTAAACATCCTTGACTGGAAGCATCTCGTATGCCG 114871 1.0735863331322382 No Hit
TCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAA 112198 1.048604429357896 Illumina Single End Adapter 1 (100% over 21bp)
TCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAA 110008 1.0281366518547872 Illumina Single End Adapter 1 (95% over 23bp)
ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAC 94442 0.8826565492915952 Illumina Single End Adapter 1 (95% over 24bp)
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAC 82271 0.7689061748667841 No Hit
TGAGGTAGTAGGTTGTATAGTTATCTCGTATGCCGT 77257 0.7220452450035024 No Hit
GTAGTGTTTCCTACTTTATGGAATCTCGTATGCCGT 62069 0.5800979369134498 No Hit
GTATGCCGTCTTCTGCTTGAAAAAAAAAAAAACAAA 58659 0.5482280185181984 No Hit
Hi Palgrave,

From the pdf file provided by illimina, you will find ATCTCGTATGCCGTCTTCTGCTTG is actually the v1.5 Small RNA 3' Adapter. Never mind those tailing poly-A as they are fake base-calls by the illumina sequencer if there is no base detected. A mature adapter trimmer will trim those tailing poly-A next to adapter sequence.

Though trimmomatic seems to be specifically optimized for small RNA adapter trimming, I also recommend you using the skewer (http://sourceforge.net/projects/skewer ) tool which is not optimized for any specific applications but performs equally well or even better for small RNA adapter trimming.

For your case, the command is very simple like this:
Code:
skewer -x ATCTCGTATGCCGTCTTCTGCTTG -l 16 -L 30 yourData.fastq
relipmoc is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO