
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
align short query against 300M Illumina reads hohllp Bioinformatics 5 11-21-2011 01:40 PM
YASRA (Yet Another Short Read Assembler) HereBeDragons Bioinformatics 4 04-04-2011 04:11 PM
De Novo Short Read Assembler? doxologist De novo discovery 18 05-21-2010 06:55 AM
looking for reference genome based assembler for short-reads zchou Bioinformatics 3 12-16-2009 09:13 PM
PubMed: PASS: a Program to Align Short Sequences. Newsbot! Bioinformatics 0 02-17-2009 06:00 AM

Thread Tools
Old 06-02-2011, 09:58 PM   #1
Junior Member
Location: Australia

Join Date: Apr 2010
Posts: 6
Default Looking for assembler to align very short reads

Hi all,

Now I have a question, when I tried to align several very short length of reads, I used cap3, it cannot get the consensus sequence. The input file list below:

Obviously, there is one part sequence 'GGGAAACCATCCTATACGAAAAA' can be align from above sever reads. However, when I run it on cap3, it get nothing. Any one can recommend a better assembler? I expect to get the .ace file as out.

Last edited by andylai; 06-02-2011 at 10:04 PM.
andylai is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 08:33 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO