SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
very low percent uniquely mapped for only one read out of the pair hello_world RNA Sequencing 5 04-10-2014 12:37 AM
bwa: Read unmapped in proper pair dariober Bioinformatics 3 09-06-2013 08:27 AM
tophat marking "read in a proper pair" wrongly jay2008 Bioinformatics 3 08-12-2013 01:38 AM
Reads not mapped in proper pair: Bowtie output RGP Bioinformatics 4 12-14-2011 07:21 AM

Reply
 
Thread Tools
Old 12-31-2018, 05:33 AM   #1
PBMS
Junior Member
 
Location: UK

Join Date: Dec 2018
Posts: 1
Question Read mapped in proper pair (0x2) flag in SMALT aligner

Hi,

I used SMALT to align MiSeq PE reads to a single-strand, unsegmented viral reference genome. When I looked into the results, I found some pairs were not flagged as "read mapped in proper pair (0x2)," but it seemed to me that they should be proper pairs.

I listed two pairs that I think should be proper pairs but did not get the 0x2 flag as below. Reads were adapter-trimmed and quality-trimmed by Trimmomatic before aligned by SMALT, so the length was different between reads.

SMALT commands:
smalt map -x -y 0.7 -j 0 -i 2000 -o sample_X.sam ref_index read_1.fastq read_2.fastq

First one:
MISEQ:1:1101:2325:10343 81 ref 5130 29 2S210M = 5130 210
GCAGCCAAGCACAAAACCACGTCCAAAAAATCCACCAAAAAAAGATGATTACCATTTTGAAGTGTTCA
ACTTTGTTCCCTGTAGTATATGTGGCAACAATCAACTCTGCAAATCCATTTGCAAAACAATACCAAGC
AACAAACCAAAAAAAAAACCAACTACAAAACCCACAAACAAACCACCCACCAAAACCACAAACAAAAG
AGACCCCA

5GE6>99C9C=,8@BCGGFB6:>EECFCF:F7FFCF<:9FGFFDGD@FECEC,FCCECFB9GFCCFDC
<=FFD<EFGGGGEAFFF<?,B,<EFFGCFFD@ADFGFEEA9GGFAGFFCE<@GFF9EFF<C5,FC,9E
C<EE7GGGEGGGGGGFD,GFF6EFFGGFCCGGFEFFCEGEGGGGFGFDCGFF@GFGGGGGGFFDDGGF
9GFCCCCC
NM:i:1 AS:i:207

MISEQ:1:1101:2325:10343 161 ref 5130 29 3S159M = 5130 -210
GGCAGCCAAGCACAAAACCACGTCCAAAAAATCCACCAAAAAAAGATGATTACCATTTTGAAGTGTTC
AACTTTGTTCCCTGTAGTATATGTGGCAACAATCAACTCTGCAAATCCATTTGCAAAACAATACCAAG
CAACAAACCAAAAAAAAAACCAACTA

CCCCCGGGGG<FGGGGGGDGGGCCFGGGGGGFGFGDFGGGGGGGGGECFE,EDCFFFAECEGFCFACF
GGDEF,@FFDEFFCFGGGGGGF9F<A=EFCFGF8FFFCFCCDFGGG=FGGCFGGCEFCGEFDFF8FG<
FFG:FFF<FEGGGGGGGGGC8EG8,>
NM:i:1 AS:i:15


Second one:
MISEQ:1:1101:2472:14296 81 ref 4225 29 4S260M = 4225 -260
GCGGGGGGTAAATAGATATCAGTTAGAGTTTAACCAATCTTAACAACCATCTATACCGCCAATCCAAT
ACATACATTGCAAATCTTAAAATGGGAAACACATCCATCACAATAGAATTCACAAGCAAATTTTGGCC
CTATTTTACACTAATATATATGATCCTAACTCTAATCTCTTTACTAATTATAATCACCATTATGATTG
CAATACTAAATAAGCTAAGTGAACATAAAATATTCTGCAACAAGACTCTTGAACAAGGAC

>9970F7FGGGGGGGGGGGFGEGGDFGED8GGFGFCGGFAGF8EEF?GGGGFFEGE=??GGFGGGGGE
EGGGGGDFGGDGFGFFEGGGGGGECFFFCGGGGFGFFGGF9GFGGGFGFFGGFGFAAF8GF<@FB<CF
FGGGGGFGGFDFGGGGGGGF@FC<CGGGGFADGGFCGFAAEDGGGGGGGGGGGDGGGGGGGGGGGFGG
GFDGGFAGGGGF@DGGGFGFCFFFEFDFAFAFEAGGGGGGGGEECGFF<AGGGGGCCCCC
NM:i:1 AS:i:257

MISEQ:1:1101:2472:14296 161 ref 4225 29 4S260M = 4225 260
GCGGGGGGTAAATAGATATCAGTTAGAGTTTAACCAATCTTAACAACCATCTATACCGCCAATCCAAT
ACATACATTGCAAATCTTAAAATGGGAAACACATCCATCACAATAGAATTCACAAGCAAATTTTGGCC
CTATTTTACACTAATATATATGATCCTAACTCTAATCTCTTTACTAATTATAATCACCATTATGATTG
CAATACTAAATAAGCTAAGTGAACATAAAATATTCTGCAACAAGACTCTTGAACAAGGAC

CCCCCGGGGFGFGFGFFG,CFGGFGGGGDFFFFE?FGGGFGAFBFGFGGGGGGGGF9FFGGGGGCGGF
GGGGGGGGF9FFGFGGGGGGGCFGG8FFFGGGGGGCFFGGGF9=FEGGGGFGFFGCBCFGFGB,@FFG
FGGGGGEF?@FFFGEGGFCFGG9ECCFGGG;9;FFGGGGG9F9CFG?C9CFGFFGCF??9CGE?GGCE
FFGGGGGGGGGGCFCEFF9C*0:FGC7CFBGGGGFFFFFCD555CFFFFF*=?FFFF>?F
NM:i:1 AS:i:257


Flag 81: read paired (0x1), read reverse strand (0x10), first in pair (0x40)
Flag 161: read paired (0x1), mate reverse strand (0x20), second in pair (0x80)

Does anyone have any idea why they were not flagged as proper flags? I have not managed to figure it out, so any thought would be greatly helpful.

Best,
Michael

Last edited by PBMS; 12-31-2018 at 05:51 AM.
PBMS is offline   Reply With Quote
Reply

Tags
proper pair, smalt

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:04 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO