SEQanswers

Go Back   SEQanswers > Applications Forums > Epigenetics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie. Different outputs from equivalent(?) inputs. AEB Bioinformatics 1 08-18-2011 12:34 AM
always reads on plus strand more than on minus strand tujchl Bioinformatics 4 04-29-2011 12:08 AM
different number of reads mapped to plus strand and minus strand gfmgfm Bioinformatics 2 02-03-2011 10:26 AM
Bowtie, BWA, strand information Zimbobo Bioinformatics 6 04-24-2010 08:30 AM
Bowtie: ?'s about h_sapiens_37_asm index/outputs cutcopy11 Bioinformatics 2 11-10-2009 06:56 PM

Reply
 
Thread Tools
Old 03-23-2011, 05:56 AM   #1
tujchl
Member
 
Location: BEIJING, CHINA

Join Date: Sep 2009
Posts: 74
Default which one indicate strand on bowtie outputs?

HI everyone:
I use bowtie to map reads to genome on Galaxy using recommend option. and results like below (just one read show here):
HWUSI-EAS455_0034_FC630CNAAXX:4:1:1045:9169#0/1 16 chr10 10711690
255 40M * 0 0 GGATGTTGGAGTGCCCAGTGTACTCCATTTCAAAATACTA
HHHHHHDGHGHHHHGHHHHHHFGDGDGHHFHHHHHHHGGG XA:i:0 MD:Z:40 NM:i:0

could you point out which is indicate strand of my reads mapped to? I known 16 on the 2nd column indicates - and 4 is nomatch and do you know 0 indicates what? (0 is highly prevail in my data)

By the way there are always 0,4,16 in my data, Is it normal?

Last edited by tujchl; 03-23-2011 at 06:26 AM.
tujchl is offline   Reply With Quote
Old 03-23-2011, 08:31 AM   #2
ttnguyen
Member
 
Location: Ireland

Join Date: Mar 2010
Posts: 41
Default

You may want to refer to these for further information about SAM format:
http://bowtie-bio.sourceforge.net/ma...-bowtie-output
http://samtools.sourceforge.net/SAM1.pdf

It is normal to output 0,4,16 often. You can use the code below to count the number of 0, 4, 16,.... in your SAM. In SE data, the proportion of reads mapped to forward strand (0) should be approximately equal to the proportion of reads mapped to reverse strand (16).

awk 'BEGIN {FS=OFS="\t"} {a[$2]++} END{for (i in a) print i, a[i]}' SAM_FILE
ttnguyen is offline   Reply With Quote
Old 03-23-2011, 09:45 AM   #3
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Default

this might be of interest to you: http://picard.sourceforge.net/explain-flags.html
volks is offline   Reply With Quote
Old 03-23-2011, 05:20 PM   #4
tujchl
Member
 
Location: BEIJING, CHINA

Join Date: Sep 2009
Posts: 74
Default

Got it! thank you
tujchl is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:11 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO