SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TopHat Error: Could not find Bowtie index files /bowtie-0.12.5/indexes/. rebrendi Bioinformatics 11 06-22-2016 09:55 AM
bowtie index problem (bowtie-build and then bowtie-inspect) tgenahmet Bioinformatics 4 09-10-2013 11:51 AM
Bowtie. Different outputs from equivalent(?) inputs. AEB Bioinformatics 1 08-18-2011 12:34 AM
which one indicate strand on bowtie outputs? tujchl Epigenetics 3 03-23-2011 05:20 PM
Bowtie Index Question Wei-HD Bioinformatics 5 07-29-2010 08:15 AM

Reply
 
Thread Tools
Old 11-10-2009, 02:18 PM   #1
cutcopy11
Member
 
Location: Purdue University

Join Date: Nov 2009
Posts: 19
Default Bowtie: ?'s about h_sapiens_37_asm index/outputs

Hello,

1)
I have a questions about bowtie's "h_sapiens_37_asm" index.
For the human genome, the concise reference sequences are numbered 0 to 24. I
assume these numbers represent chromosomes. Is 0 chromosome 1? What about X,
Y, and the M?

bowtie -z -f h_sapiens_37asm --concise reads/seq_human.fa human_map

2)
I am also confused about the localization of the 5' end of the read.

According to the dafault output description, the fourth column shows the
"0-based offset into the forward reference strand where leftmost character of
the alignment occurs."

If you don't use the concise option ...

if a read is mapped 5' to 3' from position 1000 to 1035,
the fourth column should be 1000, right?

If a read is mapped 5' to 3' from position 1035 to 1000,
will the fourth column be 1035 or 1000?
I think this means the fourth column will be 1000.
If this is the case, is there an "option" so that I can make it 1035 instead of 1000?

Thanks,
Clayton
cutcopy11 is offline   Reply With Quote
Old 11-10-2009, 06:40 PM   #2
Ben Langmead
Senior Member
 
Location: Baltimore, MD

Join Date: Sep 2008
Posts: 200
Default

Hi Clayton,

Sorry - I saw your email and meant to reply immediately but it's probably better to reply here anyway...

Quote:
Originally Posted by cutcopy11 View Post
1)
I have a questions about bowtie's "h_sapiens_37_asm" index.
For the human genome, the concise reference sequences are numbered 0 to 24. I
assume these numbers represent chromosomes. Is 0 chromosome 1? What about X,
Y, and the M?

bowtie -z -f h_sapiens_37asm --concise reads/seq_human.fa human_map
It's 0=chr1, 1=chr2, ..., 21=chr22, 22=X, 23=Y, 24=MT. Not wanting anyone to have to contend with these numbers is one of the reasons I'm likely to deprecate --concise soon (I've already deprecated -b/--bin).

Quote:
Originally Posted by cutcopy11 View Post
2)
I am also confused about the localization of the 5' end of the read.

According to the dafault output description, the fourth column shows the
"0-based offset into the forward reference strand where leftmost character of
the alignment occurs."

If you don't use the concise option ...

if a read is mapped 5' to 3' from position 1000 to 1035,
the fourth column should be 1000, right?

If a read is mapped 5' to 3' from position 1035 to 1000,
will the fourth column be 1035 or 1000?
I think this means the fourth column will be 1000.
If this is the case, is there an "option" so that I can make it 1035 instead of 1000?

Thanks,
Clayton
You're right that it will be 1000 in both cases. There's no option to invert that for reads on the reverse strand, but it's easy to convert Bowtie's output to your desired output with a little postprocessing. An example:

Quote:
$ ./bowtie --quiet -c e_coli GGTGCGTTACTGTGGCACTTCGNCCTGATGTGGAT,GCATTTTTTTCGCCAGCCAGGCTTTCGCTTTGGGT
0 - gi|110640213|ref|NC_008253.1| 4769855 ATCCACATCAGGNCGAAGTGCCACAGTAACGCACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0 22:G>N
1 + gi|110640213|ref|NC_008253.1| 2365447 GCATTTTTTTCGCCAGCCAGGCTTTCGCTTTGGGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0
$ ./bowtie --quiet -c e_coli GGTGCGTTACTGTGGCACTTCGNCCTGATGTGGAT,GCATTTTTTTCGCCAGCCAGGCTTTCGCTTTGGGT | awk -v OFS='\t' '{if($2 == "-") {$4 += (length($5)-1)} ; print $0}'
0 - gi|110640213|ref|NC_008253.1| 4769889 ATCCACATCAGGNCGAAGTGCCACAGTAACGCACC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0 22:G>N
1 + gi|110640213|ref|NC_008253.1| 2365447 GCATTTTTTTCGCCAGCCAGGCTTTCGCTTTGGGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0
Ben
Ben Langmead is offline   Reply With Quote
Old 11-10-2009, 06:56 PM   #3
cutcopy11
Member
 
Location: Purdue University

Join Date: Nov 2009
Posts: 19
Default

Thanks Ben
cutcopy11 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:16 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO