SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
What are the differences between alignment, mapping, and assembly in Bioinfomatics? Felix0902 Bioinformatics 15 05-23-2016 03:10 AM
CAP3 download pari_89 Bioinformatics 0 05-03-2013 02:30 AM
Settings for cap3 assembly of cDNA to genomic data mycorr10 Bioinformatics 10 02-08-2012 03:40 AM
Regarding PCAP and CAP3 ganga.jeena Bioinformatics 0 12-31-2010 12:25 AM
Alignment/assembly programs - Patent minefield GerryB Bioinformatics 3 06-08-2009 08:05 AM

Reply
 
Thread Tools
Old 07-12-2013, 10:01 PM   #1
ysnapus
Member
 
Location: Mid-Atlantic

Join Date: Jun 2013
Posts: 22
Default inconsistent CAP3 assembly and alignment

I have 5 related EST sequences and I want to assemble contigs. I am using the sequence assembly program CAP3. Here is my data:
Code:
>ES981358
GTTACTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA
>EV115773
ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGTTGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCATCGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGGGTGCACCGTGCCTGACCAGTC
>EV115686
GGTATATGAAACCTTTGAACAAACTATTGGACTAAAATGGATTCCACAATCTTGTTTTGTTTATATGAAAGGAAGAAAACATCTCCTATAACTTTTTATGAAGTTATATAACATTTTTGCCTTAATGGTACAAAACCTCAACGGGAATGTTGAAATTGCATTAACCTCAAAGCTATTGAGAAGCTGCGAAACTGCGAAGTGAGATCACAGCTGCACGGAGCAGAAGAATCAAACATCTAACTATGTTTCCTAATATGTATATGGAGCTTTCGTTTATTCATATCAATTGTTTCTTGATGCTGAATCACATTGAAAGGTCAAGCGACTAGATCGACTTCATCACGTTGAGGGTAAACCACATCGAGTCTCATCATACTCTTGTACTGGTCAGGCACCGGTGCACCACCTTGCACACACAACTCCACAACCGCAGGAGCTTTCCCATAAAACCTCTGCAAGCTATTGTCAAGAGCAGAAGAATCTGGATCCCGAACATGCCAAACATAGTTTGGACCGACCACGTCGTCAATAGTCGCTTCTTGCCACGCGTGCATTCCGTCTCGCATCTGATGTTTTGTCGCTTTACACATCTTCACTTTGTGTCCCTTTGGACCCACTTGAATCTCTGGACAGTAACCACATGTCCACACTTTGTATCTCTCCATCAGTTTCTTGACCCCTGTGACCATTTCAAACCATGAGTCCATCGTCTCAACGCTTAACTCCTTCAAGCTCTTCTTCTCTGTACTGTAATGA
>EV005953
GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCTTCTCACTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCA
>EE435034
TTATATTGAGGAGATCCCCCGGTGGAGGATGTTAACCGAGATATCTCGGAGAAATATTCGTGCGGGATTTAGCATGATAACGAGGCTCAAAAAATGAAAAGTAGTCTAGCAATTGTAAGCTGAGGACTCTTTCACACAGGAAATAGCTATGATCATGATCATCGCTGGAGATTCTGCTCTGAGGATCACATTGTTTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGGTAGATTTCGAGGAAGTCAACAAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGTTCACAGGGGTCA


When I run this through CAP3, I get a contig of EV005953+, EV115686-, and ES981358+, shown below:
Code:
EV005953+             GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCA
EV115686-                                                                      TCA
                      ____________________________________________________________
consensus             GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTT
EV115686-             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTT
                      ____________________________________________________________
consensus             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGACTCATGGTT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             TGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTA
EV115686-             TGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTA
ES981358+                                                                     GTTA
                      ____________________________________________________________
consensus             TGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAAATACAAAGTGTGGACATGTGGTTA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             CTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
EV115686-             CTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
ES981358+             CTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
                      ____________________________________________________________
consensus             CTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             GCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG
EV115686-             ACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG
ES981358+             ACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGG
                      ____________________________________________________________
consensus             ACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             TCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
EV115686-             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
ES981358+             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
                      ____________________________________________________________
consensus             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             GAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
EV115686-             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
ES981358+             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
                      ____________________________________________________________
consensus             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             ACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
EV115686-             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
ES981358+             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
                      ____________________________________________________________
consensus             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             CGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAA
EV115686-             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA
ES981358+             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA
                      ____________________________________________________________
consensus             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTG
EV115686-             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG
ES981358+             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG
                      ____________________________________________________________
consensus             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             CAGCT                                                       
EV115686-             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT
ES981358+             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT
                      ____________________________________________________________
consensus             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA
ES981358+             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA
                      ____________________________________________________________
consensus             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT
ES981358+             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT
                      ____________________________________________________________
consensus             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             AGTCCAATAGTTTGTTCAAAGGTTTCATATACC
ES981358+             AGTCCAA                          
                      ____________________________________________________________
consensus             AGTCCAATAGTTTGTTCAAAGGTTTCATATACC
However, I saw somewhere else that actually EV115773 should also align with the other sequences. To test this I gave just the relevant 4 sequences as the input:
Code:
>ES981358
GTTACTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA
>EV115773
ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGTTGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCATCGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGGGTGCACCGTGCCTGACCAGTC
>EV115686
GGTATATGAAACCTTTGAACAAACTATTGGACTAAAATGGATTCCACAATCTTGTTTTGTTTATATGAAAGGAAGAAAACATCTCCTATAACTTTTTATGAAGTTATATAACATTTTTGCCTTAATGGTACAAAACCTCAACGGGAATGTTGAAATTGCATTAACCTCAAAGCTATTGAGAAGCTGCGAAACTGCGAAGTGAGATCACAGCTGCACGGAGCAGAAGAATCAAACATCTAACTATGTTTCCTAATATGTATATGGAGCTTTCGTTTATTCATATCAATTGTTTCTTGATGCTGAATCACATTGAAAGGTCAAGCGACTAGATCGACTTCATCACGTTGAGGGTAAACCACATCGAGTCTCATCATACTCTTGTACTGGTCAGGCACCGGTGCACCACCTTGCACACACAACTCCACAACCGCAGGAGCTTTCCCATAAAACCTCTGCAAGCTATTGTCAAGAGCAGAAGAATCTGGATCCCGAACATGCCAAACATAGTTTGGACCGACCACGTCGTCAATAGTCGCTTCTTGCCACGCGTGCATTCCGTCTCGCATCTGATGTTTTGTCGCTTTACACATCTTCACTTTGTGTCCCTTTGGACCCACTTGAATCTCTGGACAGTAACCACATGTCCACACTTTGTATCTCTCCATCAGTTTCTTGACCCCTGTGACCATTTCAAACCATGAGTCCATCGTCTCAACGCTTAACTCCTTCAAGCTCTTCTTCTCTGTACTGTAATGA
>EV005953
GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCTTCTCACTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCA


Now, I get an alignment where all the 4 sequences align:
Code:
                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGT
                      ____________________________________________________________
consensus             ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             TGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCAT
                      ____________________________________________________________
consensus             TGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCAT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             CGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGC
                      ____________________________________________________________
consensus             CGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGC

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             ATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGC
                      ____________________________________________________________
consensus             ATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGC

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             GACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTT
                      ____________________________________________________________
consensus             GACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             ATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAG
                      ____________________________________________________________
consensus             ATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             GCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATC
                      ____________________________________________________________
consensus             GCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATC

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             GAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACT
                      ____________________________________________________________
consensus             GAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             AATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAG
EV005953+                         ACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAG
EV115686-                                                   TCATTACAGTACAGAGAAGAAG
                      ____________________________________________________________
consensus             AATTCTACTACTACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC
EV005953+             AGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTC
EV115686-             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC
                      ____________________________________________________________
consensus             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG
EV005953+             AAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTG
EV115686-             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG
ES981358+                                                  GTTACTGTCCAGAGATTCGAGTG
                      ____________________________________________________________
consensus             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
EV005953+             GGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGA
EV115686-             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
ES981358+             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
                      ____________________________________________________________
consensus             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
EV005953+             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCAT
EV115686-             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
ES981358+             ATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
                      ____________________________________________________________
consensus             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             GTTCGGGATCCAGATTCTTCTGCTCTTGACA-TAGCTTGCAGAGGTTTTATGGGAAAGCT
EV005953+             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
EV115686-             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
ES981358+             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
                      ____________________________________________________________
consensus             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115773+             CCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGG                            
EV005953+             CCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGT
EV115686-             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT
ES981358+             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT
                      ____________________________________________________________
consensus             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCT
EV115686-             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT
ES981358+             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT
                      ____________________________________________________________
consensus             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             TTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACAT
EV115686-             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT
ES981358+             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT
                      ____________________________________________________________
consensus             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV005953+             ATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCT              
EV115686-             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG
ES981358+             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG
                      ____________________________________________________________
consensus             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT
ES981358+             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT
                      ____________________________________________________________
consensus             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC
ES981358+             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC
                      ____________________________________________________________
consensus             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAATAGTTTGTTCAA
ES981358+             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA            
                      ____________________________________________________________
consensus             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAATAGTTTGTTCAA

                          .    :    .    :    .    :    .    :    .    :    .    :
EV115686-             AGGTTTCATATACC
                      ____________________________________________________________
consensus             AGGTTTCATATACC


This seems to be correct. So why did the first run not align EV115773 ut gave it as a singlet? How can we correctly run CAP3 to give consistent results? All of this can be checked using the online CAP3 page at http://pbil.univ-lyon1.fr/cap3.php or by downloading CAP3 from http://seq.cs.iastate.edu/cap3.html
ysnapus is offline   Reply With Quote
Reply

Tags
assembly, cap3, est, est est alignment

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:26 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO