Is there a way to report the right-most end of an alignment in a bam file? The position given is the left-most part of the alignment, but I need to know where the right-end falls in the reference. I know this can be done with the CIGAR string, but I'm concerned that I don't fully understand how the CIGAR string works with regards to hard & soft clipping, as well as what its reporting with regards to chimeric alignments. I think it might be easy to get this wrong if I'm not careful, and if there is an already existing, robust & convenient tool or method I'd prefer using that.
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
The easiest way to do this is to map with BBMap, using the "stoptag" flag, which will make it write an extra tag to each line prefixed by YS:i: which gives the read's stop location. I don't currently have a way to do that for existing sam/bam files, but I may incorporate it into reformat.
This is the code I use:
Code:public static int calcCigarLength(String cigar, boolean includeHardClip){ if(cigar==null){return 0;} int len=0; int current=0; for(int i=0; i<cigar.length(); i++){ char c=cigar.charAt(i); if(Character.isDigit(c)){ current=(current*10)+(c-'0'); }else{ if(c=='M' || c=='=' || c=='X' || c=='D' || c=='N' || c=='S'){ len+=current; }else if (c=='H'){ if(includeHardClip){len+=current;} }else if(c=='I'){ //do nothing }else if(c=='P'){ throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n"); //'P' is currently poorly defined }else{ throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n"); } current=0; } } return len; }
Code:public static String makeStopTag(int pos, int seqLength, String cigar, boolean perfect){ return "YS:i:"+(pos+((cigar==null || perfect) ? seqLength : -countLeadingClip(cigar, false)+calcCigarLength(cigar, false))-1); } public static int countLeadingClip(String cigar, boolean includeHardClip){ if(cigar==null){return 0;} int len=0; int current=0; for(int i=0; i<cigar.length(); i++){ char c=cigar.charAt(i); if(Character.isLetter(c) || c=='='){ if((includeHardClip && c=='H') || (SUBTRACT_LEADING_SOFT_CLIP && c=='S')){ len+=current; }else{ break; } current=0; }else{ current=(current*10)+(c-'0'); } } return len; }
Last edited by Brian Bushnell; 03-18-2015, 01:21 PM.
-
Originally posted by jmartin View PostIs there a way to report the right-most end of an alignment in a bam file?
Save the script as addReadEndToBam.py (or whatever). It will print to stdout in BAM format.
Example usage:
Code:addReadEndToBam.py in.bam > out.bam # Example output alignment: M00886:29:000000000-A95CG:1:2103:5504:6001 89 LmjF.01 4 0 34M = 4 0 CCCTAACCCTAACCTTGACCCTAACCCTATCCCT FB0AA0AAB1BBBA11GFCGFAB1>B1>1>>>>> XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:5 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:14C14A4 YS:i:37
Code:#!/usr/bin/env python import pysam import sys insam= sys.argv[1] samfile = pysam.AlignmentFile(insam, "rb") outfile = pysam.AlignmentFile("-", "wb", template=samfile) for aln in samfile: ys= aln.reference_end if not ys: ys= -1 aln.setTag('YS', ys) outfile.write(aln) samfile.close() outfile.close() sys.exit()
Comment
Latest Articles
Collapse
-
by seqadmin
The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...-
Channel: Articles
05-06-2024, 07:48 AM -
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
04-22-2024, 07:01 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Yesterday, 06:35 AM
|
0 responses
15 views
0 likes
|
Last Post
by seqadmin
Yesterday, 06:35 AM
|
||
Started by seqadmin, 05-09-2024, 02:46 PM
|
0 responses
21 views
0 likes
|
Last Post
by seqadmin
05-09-2024, 02:46 PM
|
||
Started by seqadmin, 05-07-2024, 06:57 AM
|
0 responses
18 views
0 likes
|
Last Post
by seqadmin
05-07-2024, 06:57 AM
|
||
Started by seqadmin, 05-06-2024, 07:17 AM
|
0 responses
19 views
0 likes
|
Last Post
by seqadmin
05-06-2024, 07:17 AM
|
Comment