SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Quake install problem jjjscuedu Bioinformatics 0 04-19-2012 04:18 PM
Who's running Quake? chrishah Bioinformatics 8 02-22-2012 11:55 PM
Problems with running Quake vivienne_lovely Bioinformatics 1 01-18-2012 08:32 AM
Problems with understanding Quake's outputs zlix425 Bioinformatics 1 07-17-2011 09:21 PM

Reply
 
Thread Tools
Old 05-20-2012, 02:03 AM   #1
iceice
Junior Member
 
Location: Oslo

Join Date: May 2012
Posts: 4
Angry Quake!!!!!!!!!!!!!!

After struggleing with the first two step of quake for one day, finally started the 3rd step, but got the following message:

cmd:

correct -f R1_renamed.fastq R2_renamed.fastq -k 15 -c 3.76 -m R.qcts -p 1 -q 33

Result:

8907980 trusted kmers
AT% = 0.344978
@DJDP4KN1:1:1101:10000:102173#TGACCA/1
CCAGCAGGAAGAGCTTGCCGCGTGCGGTGGGGTCGAGGTGGGTGGCGTATTCGAGGTGGTGTTTTTCCATCACCAGGATGATGTCGGCCCAGCGGCTGAT
+
terminate called after throwing an instance of 'std:ut_of_range'
what(): basic_string::substr
Aborted



Any tips?

Binbin
iceice is offline   Reply With Quote
Old 05-20-2012, 10:51 PM   #2
bryand
Junior Member
 
Location: Goettingen, Germany

Join Date: Aug 2010
Posts: 9
Default

Check the offending record in your fastq file and see if there's something weird about the quality line?
bryand is offline   Reply With Quote
Old 05-24-2012, 05:50 AM   #3
iceice
Junior Member
 
Location: Oslo

Join Date: May 2012
Posts: 4
Default

That is the first sequence in the fastq file, could not find anything wrong:

head R1_renamed.fastq
@DJDP4KN1:1:1101:10000:102173#TGACCA/1
CCAGCAGGAAGAGCTTGCCGCGTGCGGTGGGGTCGAGGTGGGTGGCGTATTCGAGGTGGTGTTTTTCCATCACCAGGATGATGTCGGCCCAGCGGCTGAT
+
CCCFFDFFHHHHHJJJJJJJJJHJIJJGHIJJHIJ<EH9BED=@BDD=BDDEDDDD7AB5?8@DDDDDDEDDDDDBDDDDDEDEDDDDDDDDCDDDDDAC

Any tips?
iceice is offline   Reply With Quote
Old 05-29-2012, 01:07 AM   #4
bryand
Junior Member
 
Location: Goettingen, Germany

Join Date: Aug 2010
Posts: 9
Default

I'd say it's because your quality score length is not as long as your sequence length. That means that quake will be trying to use the newline character as a quality score, which is out of the range of the quality score. Either find out why your sequence file is corrupted, or pad the end of the quality sequence with low quality scores.

Good luck!
bryand is offline   Reply With Quote
Old 05-29-2012, 01:39 AM   #5
gaffa
Member
 
Location: Gothenburg/Uppsala, Sweden

Join Date: Oct 2010
Posts: 82
Default

Quote:
Originally Posted by bryand View Post
I'd say it's because your quality score length is not as long as your sequence length. That means that quake will be trying to use the newline character as a quality score, which is out of the range of the quality score. Either find out why your sequence file is corrupted, or pad the end of the quality sequence with low quality scores.

Good luck!
Actually they are of equal length, it's just that the forum font is not monospaced.
gaffa is offline   Reply With Quote
Old 05-29-2012, 02:25 AM   #6
bryand
Junior Member
 
Location: Goettingen, Germany

Join Date: Aug 2010
Posts: 9
Default

Ok, how about this: Your quality scores don't correspond to the phred base that you specify? The ascii value of J is 74, and 74 - 33 = 41. I don't know how quake is evaluating the quality scores, but try lowering every quality score by 10 or so in that record and see if that fixes the problem (or at least reduce the J score).
bryand is offline   Reply With Quote
Old 05-29-2012, 02:34 AM   #7
iceice
Junior Member
 
Location: Oslo

Join Date: May 2012
Posts: 4
Question

Quote:
Originally Posted by bryand View Post
Ok, how about this: Your quality scores don't correspond to the phred base that you specify? The ascii value of J is 74, and 74 - 33 = 41. I don't know how quake is evaluating the quality scores, but try lowering every quality score by 10 or so in that record and see if that fixes the problem (or at least reduce the J score).
But why subtract 10? And how to implement?
iceice is offline   Reply With Quote
Old 05-29-2012, 02:58 AM   #8
bryand
Junior Member
 
Location: Goettingen, Germany

Join Date: Aug 2010
Posts: 9
Default

I said 10 just to test your data and see if that's the case (in case any other of your characters are above ascii score of 40). You can pretty easily change just the H and J from the command line:

perl -n -e 'tr/HIJ/EFG/; print;' fastq_to_check.fq > new.fq

Again, try it just with this one fastq entry, otherwise you're going to parse your whole illumina file.
bryand is offline   Reply With Quote
Old 05-29-2012, 11:01 PM   #9
iceice
Junior Member
 
Location: Oslo

Join Date: May 2012
Posts: 4
Default

Do you mean Quake does not use quality score greater than 40? Could not see any useful info from the manual.
iceice is offline   Reply With Quote
Old 05-29-2012, 11:41 PM   #10
bryand
Junior Member
 
Location: Goettingen, Germany

Join Date: Aug 2010
Posts: 9
Default

I'm not an author of the program, so I don't know - I've simply used it a couple of times and trying to guess as to what might in the end be causing your problem. I'd suggest you contact the authors directly and get their opinion if you can't solve it (assuming you don't want to go into the source code and figure it out for yourself)...
bryand is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:30 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO