SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Convert .gff3 file to 12-column .bed file SuzuBell Bioinformatics 2 11-07-2013 06:27 PM
Gene 12 Column BED file obifro Bioinformatics 2 10-21-2013 09:09 AM
VCF file format QUAL column ddaneels Bioinformatics 0 05-22-2012 05:44 AM
Hyphens in CIGAR column of sam file? GeneJockey Bioinformatics 3 05-08-2012 09:34 AM
[Help!] How can I extract high quality reads from the output file of NovoAlign qc.share Illumina/Solexa 0 09-27-2010 09:41 AM

Reply
 
Thread Tools
Old 04-23-2019, 10:58 AM   #1
archana87
Junior Member
 
Location: Canada

Join Date: Jul 2018
Posts: 6
Default Extract the high value column from a big file

Hi,

As I am new in this field. I am trying to get the best score with larger start length from below file. Here, the file header is like Chromosome location, score, and start length. I want top start length w.r.t its score and other details.

chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1303 TGCTCAAGTACACTCATTTCA
chr9:136028339-136029648-|NM_021996|GBGT1 5.629998 1304 GCTCAAGTACACTCATTTCAT
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217 AGCCAGATGCTGAGTACTATG
chr16:21868579-21893272-|None|None 6.0 473 TTTAATGAGTATTCTGGATTG
chr16:21868579-21893272-|None|None 6.0 5880 TTGATCCTCCCTTAACCTATC
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG

I want the output like this
chr9:136028339-136029648-|NM_021996|GBGT1 13.2 1301 TGTGCTCAAGTACACTCATTT
chr9:136028339-136029648-|NM_021996|GBGT1 10.8 1302 GTGCTCAAGTACACTCATTTC
chr12:54735989-54739299+|NM_016057|COPZ1 5.629998 216 GAGCCAGATGCTGAGTACTAT
chr12:54735989-54739299+|NM_016057|COPZ1 10.8 217
chr16:21868579-21893272-|None|None 6.0 5923 CTTCCTATTCCTCCAGCATAC
chr16:21868579-21893272-|None|None 6.0 6463 TGAAGTCATCTATCTGGTTTG


Any help is much appreciated.


Thanks
archana87 is offline   Reply With Quote
Old 04-23-2019, 01:07 PM   #2
archana87
Junior Member
 
Location: Canada

Join Date: Jul 2018
Posts: 6
Default Got it

Yahoo, I figure it out..... Anyway, any other way if we can do it then also fine...

My Answer is sort -k1,1 -k3,3nr -k2,2n infile.txt | sort -u -k1,2 --merge
archana87 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:46 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO