SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
problems with BBmap/java sfh838t Bioinformatics 5 02-28-2018 06:11 AM
Java problem when using BBmap Lukas Hellmann Bioinformatics 4 10-23-2017 05:23 AM
BBMap Error Phage Hunter Bioinformatics 5 01-14-2015 04:34 AM
coverageBed error: terminate called after throwing an instance of 'std::bad_alloc' hari_iyer16 Bioinformatics 4 04-11-2013 06:12 PM
AddOrReplaceReadGroups error (that is probably a more general system or Java error) efoss Bioinformatics 4 12-24-2012 03:01 PM

Reply
 
Thread Tools
Old 02-13-2019, 01:00 PM   #1
horvathdp
Member
 
Location: Fargo

Join Date: Dec 2011
Posts: 65
Default Why is BBmap throwing java error

Hi all,

I have some myseq data that I want to clean up using bbmap. When I give the following command, I get this error. What is wrong? I am guessing it is having a problem with the sequence I downloaded from the vendor, but I can't figure out what the issue is. Help???

./bbduk.sh in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70

java -Djava.library.path=/home/dave/bbmap/jni/ -ea -Xmx103643m -Xms103643m -cp /home/dave/bbmap/current/ jgi.BBDukF in1=Plate1_clean1_R1.fastq in2=Plate1_clean1_R2.fastq out1=Plate1_clean2_R1.fastq out2=Plate1_clean2_R2.fastq qtrim=rl trimq=20 minlen=70
Executing jgi.BBDukF [in1=Plate1_clean1_R1.fastq, in2=Plate1_clean1_R2.fastq, out1=Plate1_clean2_R1.fastq, out2=Plate1_clean2_R2.fastq, qtrim=rl, trimq=20, minlen=70]

BBDuk version 35.82
Initial:
Memory: max=104150m, free=100346m, used=3804m

Input is being processed as paired
Started output streams: 0.025 seconds.
Exception in thread "Thread-5" java.lang.AssertionError:
Error in Plate1_clean1_R1.fastq, line 1046, with these 4 lines:
GTTCGTCTCTACACTGACGACATGGTTCTACAGTCCATGTGAATACGAAGGGAAGCATTTTTTTTAAAAAGTAAATTGTTTTGTATACTGCAGTACTATGGGCTATGGTGAGACCAAGTCTCTGCTACCGTATGCGTCAGAAGATCGGAAT
+
>1>>1>AAFFDFEGGDAGEAEEE1FGHHHHHHHHHHHHHHHFHHHHHGCFGCF0E/1DFGHHGGGE1@G1AGHHHHHHHGHGEHBGHHHHHFFHHFHFG2BFFHHHHHF1101>?CFHHHHHFH1EG1FCFHHGH?EC/?11<CGHHG///
@M00619:318:000000000-B4H7N:1:1101:17348:2448 1:N:0:ATCACGAT+TCTTTCCC

at stream.FASTQ.quadToRead(FASTQ.java:722)
at stream.FASTQ.toReadList(FASTQ.java:653)
at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)
Exception in thread "Thread-6" java.lang.AssertionError:
Error in Plate1_clean1_R2.fastq, line 1145, with these 4 lines:
TCACGCTATGTACGGTAGCAGAGACTTGGTCTGGTTGCTTATTGGGTTACGGTTTGATTGTTGATTCGTGGTGGTACAACTTTAGTGACGGATGGTGATTGTTGTGATGGTAAGCTAAGGTCGTGTAGAACCATGTCGTCAGTGTCATAGC
+
1>>>AFAA?FFBGGCGGGFFGGHFBGHH1GGHHFDGGHFHHGHFFHFFGACFF/EEBDGFFDGFGHFEHEFACEEHHEHFFHH@GG12FFE/>E/F1@2GF@DGHF2221F2B>1B1B1FGHEE/?F12EDHAGEDGAFF//BBF2>FFF1
@M00619:318:000000000-B4H7N:1:1101:14067:2496 2:N:0:ATCACGAT+TCTTTCCC

at stream.FASTQ.quadToRead(FASTQ.java:722)
at stream.FASTQ.toReadList(FASTQ.java:653)
at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:111)
at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:76)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:643)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:635)
horvathdp is offline   Reply With Quote
Old 02-13-2019, 03:34 PM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,886
Default

Can you try running by specifying the memory by adding "-Xmx4g" to your command?
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO