SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Samtools "is recognized as '*'" "truncated file" error axiom7 Bioinformatics 3 11-26-2014 02:53 AM
File "/usr/lib64/python2.4/logging/__init__.py", line 718, twotwo Bioinformatics 3 08-02-2013 12:39 PM
"#" in illumina reads fastq quality line doublealice Bioinformatics 2 06-09-2012 03:18 PM
pileup file symbols "<" and ">" geraldgsw Bioinformatics 3 12-30-2011 08:19 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM

Reply
 
Thread Tools
Old 12-20-2012, 05:03 PM   #1
zinky
Member
 
Location: china

Join Date: Dec 2011
Posts: 48
Unhappy fastq file with "." in sequence line

hi everyone ,
my fastq file contains sequence with "." in it like:
@

TTTAA.GAATAATAAGTCTAATCCCCTTCTATTCTGTAGCACCACTTCGGACAGGGAAGTTAAAGATTCTTCTAATTTGGTTATAGACTGTTCTATAGTT
+
Z\_`a@QQ[Y[Qb^bfa_ghd_[deZbaebecffhhfeddeeddebeec_Z__abbbec\_d]\_c_R`bdd]]c^H^]cZ_`bcaaaa``a_`ZZTTZ_
@
CGAGTGCTGCCGGTCTCCTACGGGAGCAAGTGGCGCAGCTCAAGCAGAAGGTCATGACCCATGTCCGCCACGGCTGCCAGCTGCTGCCAGGGCCTAACGA
+
___cccecgege^[bdgf`aefadU^cebgXcdf^eag`cgfdbR\cgR\\V\HV^b_b`aZ]GGGKKGKKWWTEOQWSGGGJRGJYGGGGEGJGGGGGG
@
C.GGAGTGCAGCTCTCACAGCTGGCTGCAACCGGCACTTATCTTAAAGTGAAAGCAGTTTTTCTGTTAACAAGAGACGGGATGGGGGGGACAGGGGGATG
+
\@P``cc^aecaeghb_f]ghefhcaP^ddgfghhhdc[cbgfagXbe[bfgd]_c`_V\d`dddggddcb]_bQ]Z^Y_QFTTXGOOOEHJW^[aEEEG
@1
AACACTCCTAAGGATCAGGGCCCCTGTTATGATTCCTCGGTCTCCAGTGGCGTCCAGGGTGCCACACCGGGGGGGCGATGCAACCCCCTGGCCTTAGAAT
+
_bbeceeefgggghhiichfhiihiihhhhiiiihiiiihZe`ghdgff_gfafghfhe\bZaadeV`[_]accEOXTTX[GY_`]_aXW^P[R]_bY`b
@
C.CTCCTATACTTTAAAGGATTATGTATTTAAGGAGCTCCAGCGAGACTGG.CAGGTTACAGTGAGACAGACAGACAGACATTGGATTTGGTGCTCTCTA
+
b@P\acc`gggggfaaaghffefhh^cghfffhghhhhfhhffffh[ehhf@LL[__\e_f_\dbg`dbbdaecbXZ]`Z\_RZGZGZbb_[^b]T]Y`G
@
ATAGATGTCTGGACTCTCTTAAATGGAAACAAAGATGACTTCCTCATCTATGACAGATGTGGCCGTCTTGGGTATCACCTTGGGTTGCCTTACTCCTTCC
+
_ZZa^ccc^^e]b`acafad[bcga[^edgf`fg`XYbfg_a^ef]eg]cgdS^a^cghc`gfbaff_Z\HGLH\VV`_ZZ^]GTZW\]]]Z`RTYY_T]

for some reason , machine numbers were masked
at beginning of red sequences above ,there are "." in it . and i hava no idea what it is . so anyone can explain it and give an advice on how to deal with reads like that. thanks a lot

Last edited by zinky; 12-20-2012 at 05:56 PM. Reason: mask machine number
zinky is offline   Reply With Quote
Old 12-20-2012, 05:38 PM   #2
zinky
Member
 
Location: china

Join Date: Dec 2011
Posts: 48
Default

o i know "." means N .......
zinky is offline   Reply With Quote
Old 12-28-2012, 02:01 AM   #3
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 623
Default

... what usually happens with home-made converters qseq-to-fastq ...
sklages is offline   Reply With Quote
Old 01-01-2013, 01:34 PM   #4
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

use sed to change all the '.' to 'N'
swbarnes2 is offline   Reply With Quote
Reply

Tags
fastq reads

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:14 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO