SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Primer filtering with bbduk / bbduk2.sh Latrunculia Illumina/Solexa 0 10-07-2016 05:33 AM
Adapter trimming with BBduk PeatMaster Illumina/Solexa 4 04-01-2016 11:18 AM
bbduk for mirna mapping danova Bioinformatics 1 02-03-2016 07:01 PM
bbduk with a large reference database danova Bioinformatics 8 01-29-2016 08:56 PM
bbduk and kmer masking cmccabe Bioinformatics 2 10-30-2015 10:16 AM

Reply
 
Thread Tools
Old 04-18-2017, 06:32 AM   #1
mslider
Junior Member
 
Location: france

Join Date: Sep 2010
Posts: 24
Default Trimmomatic vs bbduk.sh

--Hi,

i have a big difference between results using bbduk.sh and trimmomatic trimming single-end reads, i have used the commands below, trimmomatic kept 99.78% survival reads whereas bbduk 91.76%. I don't know which to consider good or not.
Which parameters do you use to use to trim in a good way single-reads ?

thank you --

java -Xmx10g -jar trimmomatic-0.36.jar SE -threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:TruSeq3-SE.fa:2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

TrimmomaticSE: Started with arguments:
-threads 8 -phred33 D3_464_S2_L001_R1_001.fastq.gz Out_D3_464_S2_L001_R1_001.fastq.gz ILLUMINACLIP:/home/jtazi/save/Trimmomatic-0.36/adapters/TruSeq3-SE.fa:
2:40:15:8:true LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 49512700 Surviving: 49401731 (99.78%) Dropped: 110969 (0.22%)

bbduk.sh Xmx8g in=D3_464_S2_L001_R1_001.fastq.gz out=D3_464_S2_L001_R1_001_trimmed.fastq.gz ref=resources/adapters.fa threads=8 k=13 ktrim=r useshortkmers=t mink=5 qtrim=rl minlength=36 trimq=27

BBDuk version 36.11
Set threads to 8
maskMiddle was disabled because useShortKmers=true
Initial:
Memory: max=8232m, free=7974m, used=258m

Added 2017 kmers; time: 0.570 seconds.
Memory: max=8232m, free=7545m, used=687m

Input is being processed as unpaired
Started output streams: 0.449 seconds.
Processing time: 118.446 seconds.

Input: 49512700 reads 2475635000 bases.
QTrimmed: 7288815 reads (14.72%) 218452414 bases (8.82%)
KTrimmed: 3125475 reads (6.31%) 23413723 bases (0.95%)
Total Removed: 4077445 reads (8.24%) 241866137 bases (9.77%)
Result: 45435255 reads (91.76%) 2233768863 bases (90.23%)

Time: 119.548 seconds.
Reads Processed: 49512k 414.16k reads/sec
Bases Processed: 2475m 20.71m bases/sec
mslider is offline   Reply With Quote
Old 04-18-2017, 10:10 AM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,612
Default

See answer here.
Brian Bushnell is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:47 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO