![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
Recover only longest version of sequence from multiple sequence fasta file - help | sdmoore | Bioinformatics | 2 | 12-29-2019 10:01 PM |
Split long fasta seq into smaller seqs by removing 'n' | probean | Bioinformatics | 2 | 08-23-2016 05:39 PM |
FASTA to BAM for IGV visualization | Bubblepig | Bioinformatics | 16 | 11-19-2013 01:52 PM |
how to split a fasta file according to a list of gene ID | lran2008 | Bioinformatics | 9 | 08-15-2013 01:54 AM |
Split fastq to fasta and qual file? | ewilbanks | Bioinformatics | 8 | 01-07-2011 03:02 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: Florida, USA Join Date: May 2015
Posts: 2
|
![]()
Hi! New poster here, so please tell me if I should make any changes in post style or should have used a different subforum!
This is a x-post from StackBioinformatics, but I'm very interested in an answer and so I figured this might be the best place. I have a nucleotide sequence where I am interested in aligning reads distinctly to one or another portion of the sequence. However, I would like to use a visualization tool such as IGV to view these alignments in the context of the parent sequence. For example, I would like to split something along the lines of: >seq1 parent_sequence ACTGACTGACTGACTGACTGGTCAGTCAGTCAGTCAGTCAACACACACACACACACACAC Into: >seq1_1:20 parent_sequence subsequence_1_to_20 ACTGACTGACTGACTGACTG >seq1_21:40 parent_sequence subsequence_21_to_40 GTCAGTCAGTCAGTCAGTCA >seq1_41:60 parent_sequence subsequence_41_to_60 ACACACACACACACACACAC Then perform alignments using the split subsequences as a reference for alignment of reads, but visualize these read alignments on the parent sequence. While I'm sure it would be possible to write a script to manipulate all the alignments to all of the "split" subsequences back into the context of their original parent sequence, I am looking for a more elegant solution and trying to avoid this if possible. Is there a standard FASTA sequence description nomenclature for subsequences to accomplish what I'm describing, ideally that is recognized by programs like IGV? If there is not, I will likely still be splitting these sequences as described. Is there a suggested standard/common method for annotating/identifying these split sequence identifiers that maximizes readability? If relevant, the biological context for this question is analysis of RNA-Seq data collected after pulldown of a specific RNA-binding protein and digestion of overhanging read ends. The data should be enriched for a specific subsequence of interest, but will also contain the "parent" transcript. Alignments to both portions are of interest to me, but in different ways, and the alignments to the subsequence and the remainder of the parent sequence should be considered distinct. In terms of visualization it is helpful to view the alignments to all pieces in context of the "parent" transcript. I realize that splitting the parent sequence into two subsequences for alignment may result in loss of reads straddling the two portions, but that is acceptable given the necessity of having the two sections be distinct for alignment purposes. Thanks very much! -Dan |
![]() |
![]() |
![]() |
Tags |
fasta, identifiers, igv, nomenclature |
Thread Tools | |
|
|