SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
Why reads in unmapped.bam still align to reference genome? SpreeFu Bioinformatics 7 09-28-2014 10:14 PM
How to align reads to other reads (not to reference genome) username111 Bioinformatics 2 08-18-2014 08:49 AM
Samtools: Mapped reads and unmapped reads shadow19c Bioinformatics 1 09-27-2013 02:57 AM
Co-culture data to align to multiple genomes C9r1y Bioinformatics 1 01-29-2013 03:43 PM
using BWA to align SOLiD fastq files from 1000 Genomes tgenahmet Bioinformatics 1 10-15-2009 06:19 PM

Reply
 
Thread Tools
Old 10-23-2018, 05:18 PM   #1
SuzuBell
Member
 
Location: U.S.A

Join Date: Nov 2013
Posts: 19
Default Align unmapped reads to virus genomes

Hello,

I am trying to determine how much of the unmapped reads from a transcriptome study align to viruses. My procedure so far has been to:

1) Download the complete genome of a virus in FASTA format. Here is one example I used (https://www.ncbi.nlm.nih.gov/nuccore...1?report=fasta)

2) Take my RNA-seq fastq file and run GSNAP to align it to the reference of interest (honeybee genome).

3) Now I would like to use the .nomapping file that is output from GSNAP and see how many of its reads map to the virus FASTA file of interest.

The .nomapping file is in the below format:

HISEQ:596:HKK7FBCXX:2:2216:18465:100529 272 GroupUn3757 1317 3 6S94M * 0 0 AATGCAAAAAAATAATAAACAATGATTTTAATTTCAACGACGTAAATTTCCGAATTTTGGGTGCGAATGTAGATGACTTAATGAGAAACACTCGTTGCGG IHHC?HHHIIIIIIIIIIIIIIIHFEHG<IHHG<1HHHEIIHHIHHIHHIIIIH@IHGHHGIHHHHHIIIIIHHHHFGFGIIIIHIIIHIHGHHH?DDDD MD:Z:94 NH:i:2 HI:i:2 NM:i:0 SM:i:3 XQ:i:40 X2:i:40 XO:Z:UM XG:Z:ext

My main worries are:

1) What program/procedure would be most efficient for running step 3?
2) Does this pipeline somewhat make sense?

Last edited by SuzuBell; 10-23-2018 at 06:45 PM.
SuzuBell is offline   Reply With Quote
Old 10-24-2018, 10:04 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,813
Default

You could use bbsplit.sh from BBMap to figure this out in one step. Take a look at this thread about how to do this.

If you already have the /nomapping file you should be able to convert back to fastq reads using "reformat.sh" from BBMap suite.

Code:
reformat.sh in=file.nomapping out=reads.fq
Then use the reads file to map to viral genome using any aligner you like (including bbmap.sh).
GenoMax is offline   Reply With Quote
Reply

Tags
gsnap output, rnaseq alignment, virus

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:59 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO