SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Get fasta amino-acid BLAST result aliealexandre Bioinformatics 8 03-25-2015 03:09 AM
Blast > parsing result in Exel Giorgio C Bioinformatics 6 11-16-2011 12:16 AM
Local BLAST result annotation kvtspavan Bioinformatics 0 05-24-2011 11:12 PM
BLAST result rdu Bioinformatics 0 04-28-2011 10:22 AM
One read has many alignments starting at the same position seb567 Bioinformatics 1 02-03-2011 10:09 AM

Reply
 
Thread Tools
Old 02-01-2011, 04:41 PM   #1
khunny7
Junior Member
 
Location: UT

Join Date: Sep 2010
Posts: 2
Default Different starting position in Genbank blast result?

I am new to this field and this probably a very ignorant question.
However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast returned me this following result. As seen in the result, matched sequences are in same chromosome yet seemed to have different indices. Thus thinking those are repeated regions, I was trying to locate those. However, I could find only one not even two. My assumption is that those numbers are not really indices. Can anyone help me to understand this problem? Thank you.


>ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_5
Length=4833398


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2970579 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2970636


>ref|NT_167245.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_3
Length=4610396


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2876461 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2876518


>ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_2
Length=4795371


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 102 bits (55), Expect = 3e-20
Identities = 57/58 (99%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3100500 TGTCTTTGGACACGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 3100557
khunny7 is offline   Reply With Quote
Old 02-02-2011, 12:30 PM   #2
seb567
Senior Member
 
Location: Québec, Canada

Join Date: Jul 2008
Posts: 260
Default

Quote:
Originally Posted by khunny7 View Post
I am new to this field and this probably a very ignorant question.
However, when I did a blast search with following sequence, "TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG" blast returned me this following result. As seen in the result, matched sequences are in same chromosome yet seemed to have different indices. Thus thinking those are repeated regions, I was trying to locate those. However, I could find only one not even two. My assumption is that those numbers are not really indices. Can anyone help me to understand this problem? Thank you.


>ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_5
Length=4833398


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2970579 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2970636


>ref|NT_167245.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_3
Length=4610396


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 108 bits (58), Expect = 7e-22
Identities = 58/58 (100%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 2876461 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 2876518


>ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_2
Length=4795371


Features in this part of subject sequence:
large proline-rich protein BAT2

Score = 102 bits (55), Expect = 3e-20
Identities = 57/58 (99%), Gaps = 0/58 (0%)
Strand=Plus/Plus

Query 1 TGTCTTTGGACATGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 58
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3100500 TGTCTTTGGACACGTAAGAATTGGAGGAAAATAAATGTGGATTTGGGAAACTTTGAGG 3100557

The numbers you carefully colored in red are chromosome positions.

They are starting positions for the alignments.

-seb

Last edited by seb567; 02-02-2011 at 12:31 PM. Reason: typographical error
seb567 is offline   Reply With Quote
Old 02-02-2011, 12:45 PM   #3
khunny7
Junior Member
 
Location: UT

Join Date: Sep 2010
Posts: 2
Default

Quote:
Originally Posted by seb567 View Post
The numbers you carefully colored in red are chromosome positions.

They are starting positions for the alignments.

-seb
Thanks for you reply, I can see that there are many matches but that sequence is not repetitive over chromosome 6.
I did the local blast against hg19, and I could find only a single match.
khunny7 is offline   Reply With Quote
Old 02-02-2011, 01:13 PM   #4
seb567
Senior Member
 
Location: Québec, Canada

Join Date: Jul 2008
Posts: 260
Default

Each hit is for an alternate version of the human genome.

ref|NT_167247.1| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_5 Length=4833398

ref|NT_113891.2| Homo sapiens chromosome 6 genomic contig, GRCh37.p2 reference
assembly alternate locus group ALT_REF_LOCI_2 Length=4795371
seb567 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:38 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO