hi,
I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like
I would like to obtain a fasta file containing only aligned trasncripts like
How can I obtain this fast file from aligned bam file. Kindly guide me.
Thanks in advance
I have bam obtained by aligning to a transcriptome. Is it possible to obtain the complete sequence that has been aligned to every transcript and make a fast file out aligned sequences for every transcript. For an example, if the complete aligned sequence with respect to reference trasncript is like
Code:
>ref_tr1 aggtcgtttagtcgatatcgtga >aln_tr1 a-gtcgtttagtcgat-tcgtga
Code:
>aln_tr1 a-gtcgtttagtcgat-tcgtga >aln_tr2 agtgtcgggctgag--gcg-cc
Thanks in advance
Comment