SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Ion Torrent



Similar Threads
Thread Thread Starter Forum Replies Last Post
New RNA-Seq library prep kit epibio Vendor Forum 40 07-23-2014 01:48 AM
TruSeq or Nextera kit for library prep? rooty Sample Prep / Library Generation 12 10-29-2013 06:02 AM
New ScriptSeq v2 RNA-Seq Library Prep Kit epibio Vendor Forum 10 04-06-2012 06:05 AM
ScriptMiner small RNA-seq library prep kit smalan RNA Sequencing 0 02-16-2012 05:02 AM
Homemade illumina oligos and library prep kit elly Illumina/Solexa 3 03-24-2009 08:05 AM

Reply
 
Thread Tools
Old 10-03-2012, 06:50 AM   #1
van_nostram
Junior Member
 
Location: ^&

Join Date: Oct 2012
Posts: 2
Default Nugen multiplex library prep kit: anyone used it?

I was wondering whether anyone out there has some experience with the Nugen library prep kit, think it's called "Encore NGS Library System for Ion Torrent" or something. http://tinyurl.com/9acgoo6

My main interest is the barcoding adapters: looking at the sequences provided at the end of the user guide, it seems that their barcodes are shorter than the Ion Xpress kit (Life).

Would be interesting to know if they simply replaced the barcode and kept the A/P1 adapters the same as those used in the Ion Xpress kit

Any ideas from people experienced with this kit would be appreciated.
van_nostram is offline   Reply With Quote
Old 10-04-2012, 08:45 AM   #2
lsherlin
Junior Member
 
Location: California

Join Date: Apr 2010
Posts: 1
Default

While the Encore Library System for Ion Torrent has unique barcode sequences, the resulting libraries will have flanking sequences that are compatible with the standard Ion Torrent sequencing primers. The resulting libraries will be the same as the Ion Torrent library product with the exception of the barcodes. (However, we would not recommend a direct 'swap' of adapters from another kit into the NuGEN system. The reason is that the adapters utilize a unique chemistry and are of a different design.)

Cheers,
Luke
NuGEN Technologies
lsherlin is offline   Reply With Quote
Old 10-05-2012, 03:51 AM   #3
van_nostram
Junior Member
 
Location: ^&

Join Date: Oct 2012
Posts: 2
Default

thanks luke,

reason I'm asking is that if I use your kit I'd like to know the adapter structure such as what is commonly known for example the Ion Xpress kit.
e.g.
5'CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGAT3'
3'------------CGCACAGAGGCTGAGTCGATTCCATTGCTA5'


So for example for the Ion Xpress kit my sequences will start with the following motif:
TCAG[index of 10-12 bases]GAT[library sequence]

So based on what you wrote can I assume that were I to use the nugen barcoding system my reads would start off something like this:
TCAG[nugen index of 8 bases]GAT[library sequence]


Details of this kind for your protocol would be very useful for deciding which kit to use.

Also, it would be nice to know how many barcodes you offer. I have a kit manual (Encore® NGS Library Systems for
Ion Torrent) which lists 16 barcoded adaptors (1-8 in part #307 and 9-16 in part #308). Are there any additional barcodes you offer?

couldn't PM you for some reason...

Last edited by van_nostram; 10-05-2012 at 04:26 AM.
van_nostram is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:25 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO