SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
library preparation for Illumina sequencing Schelarina Sample Prep / Library Generation 2 05-08-2014 10:18 AM
RNA-Seq: High-Throughput Illumina Strand-Specific RNA Sequencing Library Preparation. Newsbot! Literature Watch 1 01-22-2013 12:48 AM
Library prep woes – unusual bioanalyzer profile of Illumina RNA-seq library petey Sample Prep / Library Generation 1 11-19-2012 10:00 AM
RNA-Seq: Method for improved Illumina sequencing library preparation using NuGEN Ovat Newsbot! Literature Watch 0 04-14-2011 03:50 AM

Reply
 
Thread Tools
Old 10-17-2017, 02:37 AM   #1
kinvel
Junior Member
 
Location: Russia

Join Date: Nov 2013
Posts: 1
Question 4C-seq library structure for Illumina sequencing

I’m in the middle of 4C-seq experiment and now designing primers for final PCR. I did it according to van de Werken protocol (Meth. Enzymol., 2012, 513, 89-112) and my final library structure is expected to be as follows (1):

5’AATGATACGGCGACCACCGANNNPPPPPPPPPPPPPPAAGCTT<INSERT>PPPPPPPPPPPPPPPPPPPPATCTCGTATGCCGTCTTCTGCTTG

where from 5': Illumina P5 primer, NNN – trinucleotide index to sort libraries (16 libraries should be sequenced in one run), PPPPP – viewpoint primers, and at 3’ end – the Illumina P7 primer, reverse complemented. Length of each primer is about 43 n.

The libraries are planned to be sequenced (single end) using Illumina 2500. If I properly understand the technology, after bridge PCR and removing of the P5-anchored fragments, the residual fragments attached to support through P7 will contain the reverse complemented P5 primer at their free ends and are sequenced from P5 primer.

However, when I discussed this experiment with our local NGS people, I was told that this library structure will not work and I will need custom sequencing primers, and proposed what they call universal adapters. With these adapters, the library structure (without viewpoint primers) should be as shown below (2):

5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-INSERT-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG-3’

I don’t like this structure very much, because it has 60 n adapters, and with addition of my viewpoint primers they will become as long as ~80 n. To add these adapters it will be necessary to use nested PCR, and I would like to minimize the number of PCR cycles.

So my question is could the libraries with the structure (1) be sequenced using HiSeq 2500 with Illumina P5 primer, or it is necessary to use the universal adapters to prepare libraries with structure (2)?

Thanks a lot.
kinvel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:14 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO