SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
PCR primer -- a PCR simulation on your computer gringer General 0 01-26-2012 03:03 AM
454Jr run metrics - possible PCR primer contamination NGS4YetiB 454 Pyrosequencing 0 08-18-2011 02:54 PM
Alternative index primer Andrew_Slatter Illumina/Solexa 8 02-16-2011 11:39 AM
Query :: Unable to create index file in soapaligner sujata Bioinformatics 0 02-06-2011 09:25 PM
PCR Primer Design Software for Gap-closure bulletin2007 454 Pyrosequencing 5 05-19-2010 12:58 PM

Reply
 
Thread Tools
Old 02-23-2010, 09:46 PM   #1
fusu
Junior Member
 
Location: China

Join Date: Feb 2009
Posts: 8
Default Query about modification of PCR primer index?

I am synthesizing the PCR primer for Solexa sequencing. As is known, the primer should be modified to increase the efficiency of annealling to flow cell.
Does anybody know how to modify the primers, like Phosphorothioate in the first 4 bases?
Here's the PCR Primer Index 1 I'm synthesizing CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC

Thanks.
fusu is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO