SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie Paired end 100% failed to align rahul.m.dhodapkar Bioinformatics 15 09-12-2013 03:05 PM
Hello and a Question: 50 or 100 bp reads? kerhard Introductions 0 02-11-2011 02:13 PM
Bowtie to align reads to single chromosome or region? jjw14 Bioinformatics 1 10-07-2010 07:20 PM
TopHat+BWT = reads that failed to align ~ 99% repinementer Bioinformatics 6 09-28-2010 08:31 PM
Tophat...Mapping reads against Reference with Bowtie [FAILED] Brajbio Bioinformatics 0 06-02-2010 01:33 AM

Reply
 
Thread Tools
Old 01-26-2011, 01:09 AM   #1
michy
Junior Member
 
Location: oxford

Join Date: Aug 2008
Posts: 5
Default Bowtie and reads that failed to align: (100.00%)

Hello,
Can someone help me please. I have some new paired-end sequence from illumina and the reads are not aligning. What am I doing wrong? An example of the reads are below with the commandline I am using. I would be grateful for any help, cheers.

Read from sequence file #1
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
GCTCCAGTATAGGGGAATGCCAGGACTAGGAAGAGGGATTGTGTGGTTTGGAGAGCAGGACGGAGGGAGGGTATACGTCACTATGAGATGGGAAACTTGTA
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/1
ccccc_ca\c[[]X]JYJVRRHSXHMMNYVPVZEIWFFYXXZ_Z]cbccb_J[G_VPZUF^X`H`^YD`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HISEQ2000_0110:4:68:14861:199831#GCACTG/1


Read from sequence file #2
@HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
CACTTTAAAATCTATTTGATCTTGAGGAAATCAGTTGTGTTTCCTAGTTATATAGTCTATCATTTAATAATAGCACTAATGAAGTGTTTAGAAGTAATAAT
+HISEQ2000_0110:4:68:14837:199814#GGGCGG/2
ggggggggggfbfIffffefggggeggggeU^cf_eedfee^ZZ\accdd]eeeeffedfI[bbbcYccbeaeddgggaedTcc_dbfdIc\c\P_ZM_BB


Commandline
./bowtie -t -p 14 -q -I 0 -X 300 -S --chunkmbs 2048 mus -1 ../working/s_temp_1.txt -2 ../working/s_temp_2.txt ../working/s_temp_aligned.sam
michy is offline   Reply With Quote
Old 01-26-2011, 01:43 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

Hi michy,

The command you used looks ok-ish, but

(a) -q is the default, however Bowtie will then assume Phred33 qualities. The HiSeq seems to chuck out Phred64 encoded data though, try specifiying -q --phred64-quals
(b) -I 0 is not not required as it is the default
(c) If you still don't get any alignments you might want to increase -X to a higher value, maybe your insert sizes are just larger than 300bp?

Hope (a) or (c) will fix it.
fkrueger is offline   Reply With Quote
Old 01-26-2011, 02:12 AM   #3
michy
Junior Member
 
Location: oxford

Join Date: Aug 2008
Posts: 5
Default

Hello fkrueger,
thank you for your reply. Your suggestions esp. a) and c) they did improve the alignment by 15% which means 85% still failed to align. However, I was testing the command on a small subset of the data. I will try some more reads and get back to you.

Thank you again and any other suggestions welcome.

Michy
michy is offline   Reply With Quote
Old 01-26-2011, 02:21 AM   #4
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

May I ask if you used FastQC on your sequence files to find out whether you are sequencing into the adapter on the other side? This might throw mapping efficiencies off quite a bit and can be fixed by trimming adapter sequences off or just shortening the sequences a bit.
fkrueger is offline   Reply With Quote
Old 01-26-2011, 02:59 AM   #5
michy
Junior Member
 
Location: oxford

Join Date: Aug 2008
Posts: 5
Default

Hello fkrueger,
I've never tried this software but I will now, it looks very useful.

Thank you,
Michy
michy is offline   Reply With Quote
Old 02-07-2011, 05:11 AM   #6
andrehorta
Member
 
Location: Brazil - Belo Horizonte - UFMG

Join Date: Jan 2011
Posts: 14
Default

I used the command: bowtie -p 4 /rs4244385A

And reads that failed to align: (100.00%)

Can help me?
andrehorta is offline   Reply With Quote
Old 02-08-2011, 05:02 AM   #7
andrehorta
Member
 
Location: Brazil - Belo Horizonte - UFMG

Join Date: Jan 2011
Posts: 14
Default Help!

Quote:
Originally Posted by andrehorta View Post
I used the command: bowtie -p 4 /rs4244385A

And reads that failed to align: (100.00%)

Can help me?
anyone?????
andrehorta is offline   Reply With Quote
Old 02-08-2011, 07:42 PM   #8
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

Your first read has lousy quality scores, and its best blast to mouse has several discrepancies. That's why it won't align. The second read should align fine.

rs4244385 is a human SNP.
swbarnes2 is offline   Reply With Quote
Reply

Tags
bowtie alignment illumina

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:58 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO