SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
miRDeep2 asaleh Bioinformatics 5 09-29-2017 02:29 AM
Folding RNA (urgent) renesh Bioinformatics 1 01-16-2013 02:07 PM
GATK to discover Single Nucleotide Variation in mature miRNA from miRNA-Seq Bioinfo83 Bioinformatics 0 01-31-2012 04:11 AM
miRNA-Seq with samples that have different % miRNA to Total RNA... DrDTonge Bioinformatics 0 01-12-2012 11:20 PM
PubMed: Comprehensive mapping of long-range interactions reveals folding principles o Newsbot! Literature Watch 0 10-10-2009 02:09 AM

Reply
 
Thread Tools
Old 03-26-2012, 02:09 AM   #1
RTK45
Member
 
Location: France

Join Date: Feb 2012
Posts: 11
Default mirdeep2 check mirna folding

Hi,

i have donwloaded mirdeep2 and i would like to know if my reads (wich are matures sequences) are able to make folding, then i will consider them like microRNA.

Do you know the command line wich enables this kind of test ?

Last edited by RTK45; 03-26-2012 at 02:29 AM.
RTK45 is offline   Reply With Quote
Old 03-26-2012, 05:29 AM   #2
RTK45
Member
 
Location: France

Join Date: Feb 2012
Posts: 11
Default

In fact,

i try to use the script excise_precursors.pl:

excise_precursors.pl genome.fa my_reads.arf -b

and i obtain this messsage :
Quote:
Problem with read format
Problem with read format
Problem with read format
Problem with read format
Problem with read format
...
However my reads are as in the documentation page :

.arf
The arf format is a proprietary file format generated and processed by miRDeep2. It contains information of reads mapped to a reference genome. Each line in such a file contains 13 columns. Example line:
Quote:
PAN_123456_x969696 21 1 21 ATACAATCTACTGTCTTTCCT chr22 21 46508682 46508702 ATACAATCTACTGTCTTTCCT + 1 mmmmmmmmmmmmmmmmmmmmm
Any ideas ?
RTK45 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:14 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO