SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Question about BWA mapping quality oiiio Bioinformatics 6 07-25-2011 05:33 PM
Quality Control question dicty Bioinformatics 1 02-10-2011 01:58 PM
Question about the values of quality zino SOLiD 5 05-28-2010 04:31 AM
Question quality - thoughts? nickloman Site Feedback/Suggestions 22 05-17-2010 02:55 PM
a question about fasta quality. cgjkjk Bioinformatics 0 12-17-2008 09:34 AM

Reply
 
Thread Tools
Old 02-04-2009, 10:48 AM   #1
-daf-
Junior Member
 
Location: earth

Join Date: Feb 2009
Posts: 6
Default Question about pthred quality

Hi,
i have a question about phred quality values in fastq format(Sanger).
I know that phred quality = character_code - 33 and that error probability is 10^(-phred quality/10).
So for " character(code=34), that is always appears in front of N character in sequence, quality is ~0.8 that is closest code for 0.75 error probability (all bases are equaly probable).
But what about ! character (code=33)? error probability = 1
Is it means that corresponding base in sequence wrong with probability=1 (at least >0.8) and other 3 bases equaly probable?
For example:
@SRR00XXXX
TAAGTTTTCTTATTTATATAACTACATATTTTTTTA
+SRR00XXXX
I%0IIIII,I"$EI(%$$@?2!&(02*/&",&/-'%

C in 22 position has quality ! (i.e in this position can be A or T or G but not C ?)

Last edited by -daf-; 02-05-2009 at 03:50 AM. Reason: misprint
-daf- is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:39 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO