Some questions about amplicon sequencing

[SDPA_Pet]

Hello, I'm new to Illumina. I got my sequences back from sequencing center. I did 16S rRNA amplicon sequencing with paired-ends MiSeq 2X300bp. I have 10 samples totally. I got two fastq files back. One is forward total (10sample) reads, the other is the reversed reads.

1> I checked my raw fastq files ( forward and reverse ).Reads in the files begin with barcode (8bp) + primer (20bp). This means my primers are still in the sequences.

2> Also, another thing that I don't understand. I think forwards reads should be sequenced by forward primer, and reverse reads should be sequenced by reversed primer. It is interesting both forward and reverse reads are sequenced by forward primer? (Only forward primer sequences in them, Is this possible?) Both forward and reverse reads at the beginning of each read are 8bp barcode+ 20bp forward primers.
I thought revered reads should be 8bp barcode + reversed primer and this should be at the end of each reads? Did sequencing center sort the direction for me?

3> Also, I don't understand this. When illumina does the actually sequencing? For WGS, it uses universal primers right? How about amplicon? does it use universal primers or the PCR primers.


Thanks,

[nucacidhunter]

Your discription is possible. They have used standard Illumina sequencing primers and I think you have prepared your libraries by ligating adapters to barcoded amplicons. In this case either Read1 or Read2 of pair can have barcode+forward primers but not both of them.

[SDPA_Pet]

Your discription is possible. They have used standard Illumina sequencing primers and I think you have prepared your libraries by ligating adapters to barcoded amplicons. In this case either Read1 or Read2 of pair can have barcode+forward primers but not both of them.

1>Thanks, what do you mean "but not both of them".
Both my R1 and R2 both begin with 8bp barcode + 20 bp forward primer? Do they treated this total 28bp as barcode?

2>"standard Illumina sequencing primers" -- do you mean sequenced by universal primers?

[thermophile]

Did you send the sequencing facility DNA or already amplified 16s?

[SDPA_Pet]

Did you send the sequencing facility DNA or already amplified 16s?

No, we sent our RAW gDNA.

[fanli]

Perhaps this diagram will be helpful:

http://www.illumina.com/content/dam/illumina-marketing/documents/products/appnotes/appnote_miseq_16S.pdf

P5 and P7 are the Illumina sequencing primers; these are independent of the primers you use for PCR amplification of a target region. The "universal" primers you are referring to are (possibly) the 515F and 806R set. These are designed to target conserved regions of the 16S gene, and are definitely not identical to each other. The index is your barcode - it is on the reverse primer here but has been moved to the forward primer in the latest EMP protocol. See:

http://www.earthmicrobiome.org/emp-standard-protocols/16s/

[SDPA_Pet]

Perhaps this diagram will be helpful:

http://www.illumina.com/content/dam/illumina-marketing/documents/products/appnotes/appnote_miseq_16S.pdf

P5 and P7 are the Illumina sequencing primers; these are independent of the primers you use for PCR amplification of a target region. The "universal" primers you are referring to are (possibly) the 515F and 806R set. These are designed to target conserved regions of the 16S gene, and are definitely not identical to each other. The index is your barcode - it is on the reverse primer here but has been moved to the forward primer in the latest EMP protocol. See:
http://www.earthmicrobiome.org/emp-s...protocols/16s/

I think P5 and P7 are what I mean universal primers for illumina suquencing, because whatever you sequencing (WGS or whatever of amplions).

What I don't know is why both my R1 and R2 has the same primers. In your example, my R1 reads begin with barcode+515F and R2 (reverse) begin with barcode+515 in my fastq files. I suppose R2 should be barcode+806R. I didn't do the PCR. I can't figure it out.

[thermophile]

You never see 806? Its possible they amplified v4 then ligated the adapters which would mean half would have p5+515, half would have p7+515. But if you never see 806 then they did something weird (probably bioinformatically)

[SDPA_Pet]

You never see 806? Its possible they amplified v4 then ligated the adapters which would mean half would have p5+515, half would have p7+515. But if you never see 806 then they did something weird (probably bioinformatically)

"Its possible they amplified v4 then ligated the adapters which would mean half would have p5+515, half would have p7+515." So, it is possible for barcode+only forward primer, right?

"If you never see 806" -- I am not totally sure if 806R is completely absent. However, I am pretty sure all reads no matter in R1 or R2 fastaq file begin with barcode+forward primer.

[HESmith]

This would be much clearer to explain if you'd post the following sequences (5'->3'):

1) one example of barcode+forward primer
2) one example of barcode+reverse primer
3) one example of read 1 sequence
4) one example of read 2 sequence

[thermophile]

Have you asked them about it? Ask for their wet lab methods (which you'll need for writing up this data anyway)

[fanli]

"If you never see 806" -- I am not totally sure if 806R is completely absent. However, I am pretty sure all reads no matter in R1 or R2 fastaq file begin with barcode+forward primer.

Sounds like they might have messed something up. I can't think of any way you WOULDN'T see 806R on one of the reads simply because it's part of the amplicon. I suppose you could get both primers if you did a ligation after PCR...but why?!

Have you asked them about it? Ask for their wet lab methods (which you'll need for writing up this data anyway)

Agree completely

[nucacidhunter]

1>Thanks, what do you mean "but not both of them".
Both my R1 and R2 both begin with 8bp barcode + 20 bp forward primer? Do they treated this total 28bp as barcode?

2>"standard Illumina sequencing primers" -- do you mean sequenced by universal primers?

1- Paired end sequencing output is a Read1 and a Read2 for every library strand clustered on the flow cell. For instance, you get:
(xR1,xR2), (yR1,yR2), (nR1, nR2)

If your library was prepared by ligating adapters to barcoded amplicons then for each read pair only one (R1 or R2) will start with 8 nt barcode+ 20 nt forward primer. If both R1 and R2 of a pair starts with barcode+ forward primer I do not have any explanation without knowing library prep steps.

2- Illumina has a set of sequencing primers with binding site on the adapters which is used for priming reads (R1 and any combinations of R2, index1 and index 2).

[SDPA_Pet]

1- Paired end sequencing output is a Read1 and a Read2 for every library strand clustered on the flow cell. For instance, you get:
(xR1,xR2), (yR1,yR2), (nR1, nR2)

If your library was prepared by ligating adapters to barcoded amplicons then for each read pair only one (R1 or R2) will start with 8 nt barcode+ 20 nt forward primer. If both R1 and R2 of a pair starts with barcode+ forward primer I do not have any explanation without knowing library prep steps.

2- Illumina has a set of sequencing primers with binding site on the adapters which is used for priming reads (R1 and any combinations of R2, index1 and index 2).

Hi, Here it is
The 8bp barcodes is CGTAACCA

The primers are 27F and 519R

27F: AGRGTTTGATCMTGGCTCAG
519R: GTNTTACNGCGGCKGCTG

Here is one of reads in my R1 fastq file (I thinks it is 5' to 3')

#8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFGCDGGGGGGGGGGGGGGGGGGGGGGGGDFGGFFGGFGGGGGGGGGGGGGCFEGGGGGGFGG7FGEGGGGG?EGGGGGGGGGGFGFCEGGG5CEECC9CFGE8;CECGGDGGGGGGGD?CFGFGGGEGG<C7+9<<7CGGGGCFGGGCE89CGCCC**ACFE558CEE8DFG6*:>2:>F7*0>/9*9CFFFFF*
@M02542:194:000000000-ATMHD:1:1101:8986:1003 1:N:0:5
NTGTTACTGCGGCGGCTGGCACGGAGTTAGCCGGGGTTTCTTTACCAGGTACTGTCATTATCATCCCTGGCGAAAGAGCTTTACGACCCTAAGGCCTTCATCACTCACGCGGCATGGCTAGATCAGGGTTTCCCCCATTGTCTAAGATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCATTCCCAGTGTGGCTGATCATCCTCTCAAACCAGCTATGGATCGTCGGCTTGGTAGGCCATTACCCCACCAACTACCTAATCCAACGCGGGCCTATCCTTCTCCGATACATCT

Here is the one of reads in my R2 fastq file (I am not sure if the direction is 5' to 3')

CCCCC7F@<FFFGGGGGGGGGGGGGGGGGGGGFEGGDECG,6FGGGGGGGGGGGGGE<G9FF9FGGGGGGG@FEF,6CCEGGGGGG?58+BFCGG8EF<FGG9F:CFGGCF:CCFGGGGGGGGGDEFCFGGGGGCFGGGG;FGGFGGCFGGG;FFF>@E8EE,2?FGGDFG9?FDEGGGGGGFC:BCCC9@?FF9+=F;EC7CFF75DGGG6FFG;CFFFGGGCA+;F)9469<FGF7>55*9<?BE>7?BAF1;>DE))?B=?A33F<F5<9?02286?2?4:????:F05,7.,/*1
@M02542:194:000000000-ATMHD:1:1101:9495:1005 2:N:0:5
CGTAACCAAGAGTTTGATCCTGGCTCAGGATGAACGCTAGTAGTATGCTTAATACATGCGAGTTGAACGGAAATTTTCGTGGCGAACGGGTGAGGAAAAACAGAATGCTACCTTTTAGTTTAGCACAAAAATATTCTTAGAATATTAAATACTAAATATTTTTAAAGGTCTGTGTTTTTTTTAAGCACAGTTCCGCTAAAAGATGGGTCTGTGTAAGATTAGGTAGTTGGTAAATTTAACCGCTTACCAAGCCATTGATCTTTAGTTGGTCTTTGCGGATGATCAACCACACTGGAACTG

[HESmith]

First point: sequencing is always 5'->3' (that's the directionality of DNA polymerase).

Second point: Illumina read 1 and read 2 are derived from the opposite ends and opposite strands of your amplicon.

Third point: If you're using standard sequencing primers, the beginning of read 1 and read 2 will exactly match your amplicon primers.

So let's look at your primers and read data. The beginning of read 1 matches primer 519R:

NTGTTACTGCGGCGGCTG read1
GTNTTACNGCGGCKGCTG 519R

And read 2 matches the barcode plus primer 27F:

CGTAACCAAGAGTTTGATCCTGGCTCAG read2
CGTAACCAAGRGTTTGATCMTGGCTCAG barcode+27F

As I said, it's always easier to explain when the data are available.

-Harold