SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Reply
 
Thread Tools
Old 09-14-2014, 10:52 PM   #1
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default who can help me?

the length of high throughput sequencing library is 250bp.

the sequencing quality from the P5 end is OK,but the sequencing quality from the P5 end is very bad.

sorry i don't know how to send the image .
dalin is offline   Reply With Quote
Old 09-14-2014, 11:11 PM   #2
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

sequencing quality from the P5 end
dalin is offline   Reply With Quote
Old 09-14-2014, 11:12 PM   #3
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

sequencing quality from the P7 end
dalin is offline   Reply With Quote
Old 09-14-2014, 11:28 PM   #4
woodydon
Member
 
Location: https://www.researchgate.net/profile/Woody_Lin

Join Date: Jan 2010
Posts: 52
Default

What's your question?
woodydon is offline   Reply With Quote
Old 09-15-2014, 12:02 AM   #5
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by woodydon View Post
What's your question?
why the sequencing results from P5 end and P7 end are different? Because the results are form same library.
dalin is offline   Reply With Quote
Old 09-15-2014, 08:20 AM   #6
GW_OK
Senior Member
 
Location: Oklahoma

Join Date: Sep 2009
Posts: 411
Default

What kind of sequencing library? What was the cluster density?
GW_OK is offline   Reply With Quote
Old 09-15-2014, 07:36 PM   #7
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by GW_OK View Post
What kind of sequencing library? What was the cluster density?
Thanks for your reply. The wired thing I donít understand is that, we are using a 250 bp library for PE100 sequencing. While the Q30 of p5 looks good, the P7 Q30 is really bad (except the first base). Can anyone give me some input/suggestion about this. How this happens and how to avoid this. Thanks a lot!
dalin is offline   Reply With Quote
Old 09-15-2014, 07:45 PM   #8
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

this is the sequence of the library(from T-A clone)
(P5)NNNNNNNNNNNNNNNNNNNN------GTCGGAGAATTCCTTACTAGTAGAACTCTGTTCTTGAGCTAGCATCGATGCTAGCTCAAGAACAGAGTTCTACTAGTAAGGAATTCTCCGAC----NNNNNNNNNNNNNNNNNNNN(P7)

Last edited by dalin; 09-16-2014 at 11:44 PM.
dalin is offline   Reply With Quote
Old 09-16-2014, 01:38 AM   #9
weigrc
Member
 
Location: Hong Kong

Join Date: Oct 2011
Posts: 46
Default

If the libraries are ~380 bp, the sequencing quality issue should be caused by cluster over saturation.

What are the values of Cluster Density (K/mm2) and Cluster PF (%)???

Though Read 1 and Read 2 are sequencing the same library, but Read 2 clusters re-formation will be affected a lot if too many libraries were loaded...

thanks,
Wei
weigrc is offline   Reply With Quote
Old 09-16-2014, 06:51 AM   #10
GW_OK
Senior Member
 
Location: Oklahoma

Join Date: Sep 2009
Posts: 411
Default

You can absolutely have a great R1 and and a terrible R2 due to overclustering, as weigrc said. That's why we keep asking you about the cluster density.
It also looks like your library is a not-very-diverse amplicon. That can also kill R2, even with normal clustering. You should probably decrease the amount of library loaded.
GW_OK is offline   Reply With Quote
Old 09-16-2014, 11:19 PM   #11
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by weigrc View Post
If the libraries are ~380 bp, the sequencing quality issue should be caused by cluster over saturation.

What are the values of Cluster Density (K/mm2) and Cluster PF (%)???

Though Read 1 and Read 2 are sequencing the same library, but Read 2 clusters re-formation will be affected a lot if too many libraries were loaded...

thanks,
Wei
Thank you so much!I will check the values of Cluster Density !

Last edited by dalin; 09-16-2014 at 11:22 PM.
dalin is offline   Reply With Quote
Old 09-16-2014, 11:41 PM   #12
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by GW_OK View Post
You can absolutely have a great R1 and and a terrible R2 due to overclustering, as weigrc said. That's why we keep asking you about the cluster density.
It also looks like your library is a not-very-diverse amplicon. That can also kill R2, even with normal clustering. You should probably decrease the amount of library loaded.
thanks,I will upload the date of the cluster density.
thanks for your reply, which explained a lot. Yes I am using amplicon. The worse is that my library has only about 20bp diverse sequence in 5 and 3 end. the sequence in between is a linker, means there is no diverse at all. i cannot change my library. but hope there will be a trick to circle this problem.
dalin is offline   Reply With Quote
Old 09-16-2014, 11:42 PM   #13
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by weigrc View Post
If the libraries are ~380 bp, the sequencing quality issue should be caused by cluster over saturation.

What are the values of Cluster Density (K/mm2) and Cluster PF (%)???

Though Read 1 and Read 2 are sequencing the same library, but Read 2 clusters re-formation will be affected a lot if too many libraries were loaded...

thanks,
Wei
thanks for your reply, which explained a lot. Yes I am using amplicon. The worse is that my library has only about 20bp diverse sequence in 5 and 3 end. the sequence in between is a linker, means there is no diverse at all. i cannot change my library. but hope there will be a trick to circle this problem.
dalin is offline   Reply With Quote
Old 09-17-2014, 12:20 AM   #14
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by GW_OK View Post
What kind of sequencing library? What was the cluster density?
Thanks for your reply.
I'm sorry i don't know the cluster density of the library. The Sequencing company have no information for the cluster density.
dalin is offline   Reply With Quote
Old 09-17-2014, 12:21 AM   #15
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,238
Default

I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.
nucacidhunter is offline   Reply With Quote
Old 09-17-2014, 07:17 AM   #16
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by nucacidhunter View Post
I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.
i am new in this field. can anyone tell me how to check the cluster density. just in case this is casued by amplicon diversity issue, is there any trick to aviod this problem happens again. thank you guys so much!

I will send more sequencing metrics.
dalin is offline   Reply With Quote
Old 09-17-2014, 07:24 AM   #17
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Read1

[IMG][/IMG]
dalin is offline   Reply With Quote
Old 09-17-2014, 07:27 AM   #18
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default


dalin is offline   Reply With Quote
Old 09-17-2014, 07:33 AM   #19
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

read2
dalin is offline   Reply With Quote
Old 09-17-2014, 08:47 PM   #20
dalin
Member
 
Location: china

Join Date: Sep 2014
Posts: 18
Default

Quote:
Originally Posted by nucacidhunter View Post
I wonder if you are using custom sequencing primers. Your read2 sequencing primer might not be optimal in addition to other reasons given previously. I think you need to provide more information about the library and sequencing metrics to enable others to help you effectively.
in this library,i use the custom sequencing primers
P5 primer:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
P7 primer:CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
dalin is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:27 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO