
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie and Clustering question. quantrix Bioinformatics 7 10-08-2013 06:50 AM
What does strata mean in Bowtie? xinwu Bioinformatics 14 10-14-2012 02:15 PM
Bowtie option --best --strata for unique mapper in the genome StephaniePi83 Bioinformatics 1 03-27-2012 01:29 PM
tophat with --best --strata options dariober Bioinformatics 0 02-02-2011 04:07 AM
bowtie-inspect question dicty Bioinformatics 0 12-02-2010 05:45 PM

Thread Tools
Old 11-15-2012, 06:57 AM   #1
Junior Member
Location: HOUSTON

Join Date: Nov 2008
Posts: 9
Question a question about bowtie (--best --strata)

bowtie -a --best --strata -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments to 1 output stream(s)

$ bowtie -a -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)

WHY? why --best --strata gives an extra alignment??? I got totally confused... Anyone help me out?
kaixinsjtu is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 08:03 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO