SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie and Clustering question. quantrix Bioinformatics 7 10-08-2013 05:50 AM
What does strata mean in Bowtie? xinwu Bioinformatics 14 10-14-2012 01:15 PM
Bowtie option --best --strata for unique mapper in the genome StephaniePi83 Bioinformatics 1 03-27-2012 12:29 PM
tophat with --best --strata options dariober Bioinformatics 0 02-02-2011 03:07 AM
bowtie-inspect question dicty Bioinformatics 0 12-02-2010 04:45 PM

Reply
 
Thread Tools
Old 11-15-2012, 05:57 AM   #1
kaixinsjtu
Junior Member
 
Location: HOUSTON

Join Date: Nov 2008
Posts: 9
Question a question about bowtie (--best --strata)

bowtie -a --best --strata -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA
0 - chr5 163808619 TAGACTCCTTGGTCCGTTTTT IIIIIIIIIIIIIIIIIIIII 1 6:A>C,13:T>C
0 + chr3 15801900 AAAAACGGACCAAGGAGTCTA IIIIIIIIIIIIIIIIIIIII 1 16:C>G,18:T>C
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments to 1 output stream(s)


$ bowtie -a -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA
0 + chr3 15801900 AAAAACGGACCAAGGAGTCTA IIIIIIIIIIIIIIIIIIIII 0 16:C>G,18:T>C
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)


WHY? why --best --strata gives an extra alignment??? I got totally confused... Anyone help me out?
kaixinsjtu is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:56 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO