
Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa

Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK to discover Single Nucleotide Variation in mature miRNA from miRNA-Seq Bioinfo83 Bioinformatics 0 01-31-2012 05:11 AM
miRNA-Seq with samples that have different % miRNA to Total RNA... DrDTonge Bioinformatics 0 01-13-2012 12:20 AM
miRNA-seq HiSeq2000 expression profiling problem mirandaseq Bioinformatics 0 06-09-2011 08:43 AM
Expression analysis on Human Body Map 2.0 (HiSeq2000) johannes.helmuth RNA Sequencing 0 05-13-2011 01:43 AM
PubMed: Expression profiling of microRNAs by deep sequencing. Newsbot! Literature Watch 0 04-01-2009 06:01 AM

Thread Tools
Old 06-10-2011, 06:57 AM   #1
Junior Member
Location: USA

Join Date: Jun 2011
Posts: 4
Default miRNA-seq HiSeq2000 expression profiling problem

I have a problem doing gene expression profiling of microRNAs. I have data of a miRNA-seq experiment on a HiSeq 2000 from the same rat tissue at 5 different time points. After adaptor trimming and aligning, the expression level of a given miRNA (from control, i.e. non-experimental tissue) is fluctuating across the different time points whereas one would expect the same expression level for all time points.
Attached is a plot showing the gene expression of one miRNA on a time course scale.
The following command was used to trim the adaptors:
./fastx_clipper -i /raw.fastq/miRNA.fastq -o /trimmed.adapter/miRNA.trimmed.adapter.fastq -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -l 15 -M 20 -c
This command was used for alignment in bowtie:
bowtie -k 2 -v 0 -S -p 16 -q --solexa1.3-quals /ref/ref.genome /trimmed.adapter/miRNA.trimmed.adapter.fastq /align/miRNA.trimmed.adapter.sam
We tried to align the trimmed reads against known miRNAs (from mirBase) and against the genome and had nearly the same results. We also filtered out reads that are from other non-coding RNA classes (such as rRNA, tRNA, snRNA etc). Also, discarding reads shorter than 15 bp and longer than 30 bp yielded the same results, that is variable expression level for a given miRNA in control animals.

Any help is appreciated!
Attached Files
File Type: pdf seqAnswer.miRNA.pdf (15.8 KB, 49 views)
mirandaseq is offline   Reply With Quote
Old 06-16-2011, 06:35 AM   #2

Join Date: Jun 2010
Posts: 81

how do you calculate the RPKMs ?
volks is offline   Reply With Quote
Old 06-16-2011, 06:45 AM   #3
Junior Member
Location: USA

Join Date: Jun 2011
Posts: 4

read count/(total read count * miRNA length) * 1E6
mirandaseq is offline   Reply With Quote
Old 06-16-2011, 06:50 AM   #4
not just another member
Location: Belgium

Join Date: Aug 2010
Posts: 264

So what is the question ?
NicoBxl is offline   Reply With Quote
Old 06-16-2011, 01:47 PM   #5

Join Date: Jun 2010
Posts: 81

Originally Posted by mirandaseq View Post
read count/(total read count * miRNA length) * 1E6
total read count means reads mapped to miRNAs?
volks is offline   Reply With Quote
Old 06-16-2011, 04:05 PM   #6
Junior Member
Location: USA

Join Date: Jun 2011
Posts: 4

Yes, this is what it means
mirandaseq is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 01:58 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO