|
|
|
|
|||||||
Similar Threads
|
||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Why MAQ consensus seq better than SAMtools consensus ?? | av_d | Genomic Resequencing | 5 | 10-18-2015 04:44 AM |
| Generate consensus sequence with Samtools mpileup? | Heisman | Bioinformatics | 4 | 10-28-2013 05:57 PM |
| Problem calling consensus sequence with Samtools mpileup? | Lspoor | Bioinformatics | 3 | 10-24-2011 08:43 AM |
| Consensus sequence | nitinkumar | Bioinformatics | 0 | 05-21-2011 06:38 PM |
| Why are there all these As in my consensus sequence: An issue with samtools pileup | dagarfield | Bioinformatics | 3 | 02-03-2011 11:14 AM |
 |
|
|
Thread Tools |
09-26-2011, 07:51 PM
|
#1 |
|
Junior Member
Location: Shanghai Join Date: Sep 2011
Posts: 4
|
how to use samtools to get consensus sequence?
see #2
edited. Last edited by f0415007; 09-27-2011 at 12:01 AM. Reason: explain |
|
|
|
09-26-2011, 11:59 PM
|
#2 |
|
Junior Member
Location: Shanghai Join Date: Sep 2011
Posts: 4
|
my command line:
samtools mpileup -uf [ref] [aln.bam] | /bcftools/bcftools view -cg - | /bcftools/vcfutils.pl vcf2fq > [result.fq] the result shows : @gi|110645304|ref|NC_002516.2| GCGTCGGCCTGGGCAAGACCCACCTGATGCATGCGGTGGGCAACCACCTGCTGAAGAAGA ACCCGAACGCCAAGGTGGTTTACCTGCATTCGGAACGTTTCGTCGCGGACATGGTGAAGG + .... i want to split the consensus seq to contigs at the point with 0-coverage. how may i determine the coverage of each base in the file? and i dont want any ambiguous base, is that possible to play with parameters to achieve that? what does N or n mean in the sequence? is that gaps or 0-coverage? thx for reply! |
|
|
|
|
| Thread Tools | |
|
|
