Miseq Custom primer for 16s V1V3 region

lmma · 11-12-2012, 07:23 PM

Hi Guys,
I am trying to come up with my own amplification and sequencing primers for 16s V1V3 region and I would like to get help with primer design.
I think Caporaso primer for V4 region is a good start to do modifications on. I want to understand how the primer pad was designed. In his paper, the explanation for pad region is "The amplification and sequencing primers additionally contain a new pad region to avoid primer-dimer formation with the modified adapter. " But I still don't know how to adapt this for other variable regions. Any ideas?

515F (forward primer) PCR primer sequence:
Field number (space-delimited), description:
1, 5' Illumina adapter
2, Forward primer pad
3, Forward primer linker
4, Forward primer

AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT GTGCCAGCMGCCGCGGTAA

806R (reverse primer) PCR primer sequence (each sequence contains different barcode):
2168 GoLay barcoded reverse PCR primers. Each primer is followed by a barcode identifier
generated specifically for this set of primers.
Field number (space-delimited), description:
1, Reverse complement of 3′ Illumina adapter
2, Golay barcode
3, Reverse primer pad
4, Reverse primer linker
5, Reverse primer
CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT 806rcbc0

Read 1: (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA)
Index: (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT)
Read 2: (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT)

kkrishnan · 11-28-2012, 01:21 PM

Hi Imma,
Just wondering if you have attempted and succeeded in designing primers for the V1V3 regions? I am about to try the same and any help would be great! Thanks!

csquared · 12-04-2012, 10:53 AM

The Caporaso primers are great primers and an elegant design. If you want to cover V1-V3 rather than V4, you can make an easy change to use 27F and 534R from the human microbiome project:

27F Forward
AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT AGAGTTTGATCCTGGCTCAG

534R Reverse (rcbc0)
CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC ATTACCGCGGCTGCTGG

Read 1: (TATGGTAATTGTAGAGTTTGATCCTGGCTCAG)
Index: (CCAGCAGCCGCGGTAATGGCTGACTGACT)
Read 2: (AGTCAGTCAGCCATTACCGCGGCTGCTGG)

Please verify all of the above sequences. I did the conversion a bit quickly but they should be correct.

lmma · 12-04-2012, 11:16 AM

Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.

liepa · 01-21-2013, 07:10 AM

Quote:

Originally Posted by lmma

Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.

It would be interesting to know your results as I was thinking of the same "easy convertion" and usage of V1V3 primers from 454 sequencing? Would you consider using only one index?

fozrun · 01-31-2013, 12:58 PM

Quote:

Originally Posted by lmma

Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.

Hi Imma:

Did you get your primers to work? Do they have the staggered pad so that you don't need to use PhiX? I can't seem to get e-mail or messaging to work. We're soon taking delivery of a MiSeq and want to get prepared.

Could you e-mail me at forsterr at agr dot gc dot ca

Thanks.

lotijeo · 04-23-2013, 12:33 PM

Hi Imma,
I was wondering you got any positive results using the protocol from Caporaso et al 2012. I would also like to adopt the same approach and customize some gene-specific primers using their approach. Any insights would be very appreciated.
Thanks

rohan_dandage · 01-11-2015, 04:32 PM

Hello,
I have a related query. I am set out to do an amplicon sequencing on miseq. Going through the library architectures (Illumina TruSeq DNA Adapters De-Mystified Illumina - all flavors) and adapter sequences (Illumina Customer Sequence Letter (August 12, 2014)), I have designed a strategy involving 3 simple PCR steps which skips all of recommended-kit-based-library preparation. Please have a look.

where,
P5: part of adapter that attaches to flowcell 29 nt :AATGATACGGCGACCACCGAGATCTACAC
P7: part of adapter that attaches to flowcell 24 nt :CAAGCAGAAGACGGCATACGAGAT
Read 1 : sequencing primer 33nt :ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Read 2: sequencing primer 33nt :GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
i5 :barcode 8nt
i7 : barcode 8nt

PCR1: For primer:ACACTCTTTCCCTACACGACGCTCTTCCGATCT<template for 10bp>
PCR1: Rev primer:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC<template rev 10bp>
PCR2: For primer:GATCTACAC<i5 8nt>ACACTCTTT
PCR2: Rev primer:ATACGAGAT<i7 8nt>GTGACTGGA
PCR3: For primer:P5
PCR3: Rev primer:P7

For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.

JBKri · 01-22-2015, 06:32 AM

Quote:

Originally Posted by rohan_dandage

For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.

Did you try it? Did it work?
Jon

rohan_dandage · 01-22-2015, 11:07 PM

@JBKri: I did not try actually. As ILMN won't support such strategies, I am still seeking for expert advise first.

hadarneuman · 02-25-2015, 01:26 AM

Has anyone actually used the 27F primer for Miseq? My runs didn't succeed, probably due to low Tm and low GC content of the Caporaso Read1 primer (TATGGTAATT TC AGAGTTTGATCCTGGCTCAG)... Any ideas of how to change the primer pad in order to add more GC content?
Thanks!
Hadar

bunce · 02-25-2015, 07:15 PM

Hi Hadarneuman, I would look into using locked-nucleic acid (LNA's) embedded into your sequencing primer. Fluidigm use it (e.g. A+CA+CTG+ACGACATGGTTCTACA) to artificially raise the Tm of the sequencing primer. We have found LNA-custom primers work fine - consensus seems to be to put the LNA bases at the 5' end. They are expensive but worth it if you are planning on doing a lot of sequencing with the single assay. Check out this link for more info; http://www.exiqon.com/lna-technology
Cheers, Mike

nangel · 02-26-2015, 02:13 PM

We routinely use 27F primer for Miseq (AGAGTTTGATCMTGGCTCAG). Haven't had any issues when compared to other primer sets that we have in use. When you say that your runs didn't succeed is it in failure to cluster in the sequencing run? We get usual cluster numbers and Q scores. Sample type makes a big difference in amplicon generation obviously.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
MiSeq Custom Sequencing Primer Tm?	pmiguel	Illumina/Solexa	43	11-12-2015 12:52 PM
Custom primer failed	kal33na	Illumina/Solexa	1	04-22-2013 02:39 PM
best 16s region to amplify with NGS ?	dph	Metagenomics	6	07-02-2012 05:26 PM
50+% of my HiSEQ reads are 3' primer (custom primer used)	ZAAB	Sample Prep / Library Generation	3	02-06-2012 12:00 PM
custom primer	menglv	Illumina/Solexa	3	01-18-2011 02:01 PM

11-12-2012, 07:23 PM	#1
lmma Junior Member Location: USA Join Date: Mar 2012 Posts: 2	Miseq Custom primer for 16s V1V3 region Hi Guys, I am trying to come up with my own amplification and sequencing primers for 16s V1V3 region and I would like to get help with primer design. I think Caporaso primer for V4 region is a good start to do modifications on. I want to understand how the primer pad was designed. In his paper, the explanation for pad region is "The amplification and sequencing primers additionally contain a new pad region to avoid primer-dimer formation with the modified adapter. " But I still don't know how to adapt this for other variable regions. Any ideas? 515F (forward primer) PCR primer sequence: Field number (space-delimited), description: 1, 5' Illumina adapter 2, Forward primer pad 3, Forward primer linker 4, Forward primer AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT GTGCCAGCMGCCGCGGTAA 806R (reverse primer) PCR primer sequence (each sequence contains different barcode): 2168 GoLay barcoded reverse PCR primers. Each primer is followed by a barcode identifier generated specifically for this set of primers. Field number (space-delimited), description: 1, Reverse complement of 3′ Illumina adapter 2, Golay barcode 3, Reverse primer pad 4, Reverse primer linker 5, Reverse primer CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT 806rcbc0 Read 1: (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA) Index: (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT) Read 2: (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT) Last edited by lmma; 11-13-2012 at 09:29 AM.

12-04-2012, 10:53 AM	#3
csquared Member Location: Huntsville, AL Join Date: May 2008 Posts: 67	The Caporaso primers are great primers and an elegant design. If you want to cover V1-V3 rather than V4, you can make an easy change to use 27F and 534R from the human microbiome project: 27F Forward AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT AGAGTTTGATCCTGGCTCAG 534R Reverse (rcbc0) CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC ATTACCGCGGCTGCTGG Read 1: (TATGGTAATTGTAGAGTTTGATCCTGGCTCAG) Index: (CCAGCAGCCGCGGTAATGGCTGACTGACT) Read 2: (AGTCAGTCAGCCATTACCGCGGCTGCTGG) Please verify all of the above sequences. I did the conversion a bit quickly but they should be correct. __________________ HudsonAlpha Institute for Biotechnology http://www.hudsonalpha.org/gsl

04-23-2013, 12:33 PM	#7
lotijeo Junior Member Location: Oregon Join Date: Apr 2013 Posts: 3	MiSeq amplicon paired-end libraries Hi Imma, I was wondering you got any positive results using the protocol from Caporaso et al 2012. I would also like to adopt the same approach and customize some gene-specific primers using their approach. Any insights would be very appreciated. Thanks

01-11-2015, 04:32 PM	#8
rohan_dandage Junior Member Location: new delhi Join Date: Oct 2014 Posts: 3	Hello, I have a related query. I am set out to do an amplicon sequencing on miseq. Going through the library architectures (Illumina TruSeq DNA Adapters De-Mystified Illumina - all flavors) and adapter sequences (Illumina Customer Sequence Letter (August 12, 2014)), I have designed a strategy involving 3 simple PCR steps which skips all of recommended-kit-based-library preparation. Please have a look. where, P5: part of adapter that attaches to flowcell 29 nt :AATGATACGGCGACCACCGAGATCTACAC P7: part of adapter that attaches to flowcell 24 nt :CAAGCAGAAGACGGCATACGAGAT Read 1 : sequencing primer 33nt :ACACTCTTTCCCTACACGACGCTCTTCCGATCT Read 2: sequencing primer 33nt :GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC i5 :barcode 8nt i7 : barcode 8nt PCR1: For primer:ACACTCTTTCCCTACACGACGCTCTTCCGATCT<template for 10bp> PCR1: Rev primer:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC<template rev 10bp> PCR2: For primer:GATCTACAC<i5 8nt>ACACTCTTT PCR2: Rev primer:ATACGAGAT<i7 8nt>GTGACTGGA PCR3: For primer:P5 PCR3: Rev primer:P7 For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing! If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks. Last edited by rohan_dandage; 01-11-2015 at 04:38 PM.

11-28-2012, 01:21 PM	#2
kkrishnan Junior Member Location: USA Join Date: Nov 2012 Posts: 5	Hi Imma, Just wondering if you have attempted and succeeded in designing primers for the V1V3 regions? I am about to try the same and any help would be great! Thanks!

12-04-2012, 11:16 AM	#4
lmma Junior Member Location: USA Join Date: Mar 2012 Posts: 2	Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.

01-22-2015, 11:07 PM	#10
rohan_dandage Junior Member Location: new delhi Join Date: Oct 2014 Posts: 3	@JBKri: I did not try actually. As ILMN won't support such strategies, I am still seeking for expert advise first.

02-25-2015, 01:26 AM	#11
hadarneuman Junior Member Location: Israel Join Date: Feb 2015 Posts: 1	Has anyone actually used the 27F primer for Miseq? My runs didn't succeed, probably due to low Tm and low GC content of the Caporaso Read1 primer (TATGGTAATT TC AGAGTTTGATCCTGGCTCAG)... Any ideas of how to change the primer pad in order to add more GC content? Thanks! Hadar

02-25-2015, 07:15 PM	#12
bunce Member Location: Perth Join Date: Sep 2012 Posts: 55	Hi Hadarneuman, I would look into using locked-nucleic acid (LNA's) embedded into your sequencing primer. Fluidigm use it (e.g. A+CA+CTG+ACGACATGGTTCTACA) to artificially raise the Tm of the sequencing primer. We have found LNA-custom primers work fine - consensus seems to be to put the LNA bases at the 5' end. They are expensive but worth it if you are planning on doing a lot of sequencing with the single assay. Check out this link for more info; http://www.exiqon.com/lna-technology Cheers, Mike

02-26-2015, 02:13 PM	#13
nangel Member Location: Brisbane, Australia Join Date: Nov 2014 Posts: 13	We routinely use 27F primer for Miseq (AGAGTTTGATCMTGGCTCAG). Haven't had any issues when compared to other primer sets that we have in use. When you say that your runs didn't succeed is it in failure to cluster in the sequencing run? We get usual cluster numbers and Q scores. Sample type makes a big difference in amplicon generation obviously.