![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
Bowtie and Clustering question. | quantrix | Bioinformatics | 7 | 10-08-2013 06:50 AM |
What does strata mean in Bowtie? | xinwu | Bioinformatics | 14 | 10-14-2012 02:15 PM |
Bowtie option --best --strata for unique mapper in the genome | StephaniePi83 | Bioinformatics | 1 | 03-27-2012 01:29 PM |
tophat with --best --strata options | dariober | Bioinformatics | 0 | 02-02-2011 04:07 AM |
bowtie-inspect question | dicty | Bioinformatics | 0 | 12-02-2010 05:45 PM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: HOUSTON Join Date: Nov 2008
Posts: 9
|
![]()
bowtie -a --best --strata -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA
0 - chr5 163808619 TAGACTCCTTGGTCCGTTTTT IIIIIIIIIIIIIIIIIIIII 1 6:A>C,13:T>C 0 + chr3 15801900 AAAAACGGACCAAGGAGTCTA IIIIIIIIIIIIIIIIIIIII 1 16:C>G,18:T>C # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments to 1 output stream(s) $ bowtie -a -p 6 /bowtie/indexes/hg18 -c AAAAACGGACCAAGGAGTCTA 0 + chr3 15801900 AAAAACGGACCAAGGAGTCTA IIIIIIIIIIIIIIIIIIIII 0 16:C>G,18:T>C # reads processed: 1 # reads with at least one reported alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments to 1 output stream(s) WHY? why --best --strata gives an extra alignment??? I got totally confused... Anyone help me out? ![]() |
![]() |
![]() |
![]() |
Thread Tools | |
|
|