correct syntax for species delimitation in a maf file

[balaena]

Hi,

I want to analyse and manipulate genome alignments with maffilter. So far I have only aligned two de-novo assembled genomes with LAST but as far as I can see, this can only align two genomes (which for now is sufficient, but for next genomes I have to switch to something like Mugsy I think).
But my problem for now is, how to specify species in the maf-file? The assembled scaffolds were given as two multiple fasta files to LAST, with sequence names scaffold_1, _2 etc., and that is what maffilter is complaining about (scaffold_7 invalid sequence name). So somewhere the species have to be defined (although in a two species alignment where one is the reference this should be no problem?).

I have researched the internet and nowhere I could find any clear statement how the sequences have to be named correctly either in the source fasta or in the resulting maf.

Below is the first part of the two genome maf.

Someone has an idea?

Thanks!

# LAST version 553
#
# a=7 b=1 A=7 B=1 e=35 d=14 x=34 y=7 z=34
# R=11 u=2 s=2 T=0 m=100 l=1 n=100 k=1 i=8192 w=1000 t=0.727769 g=1 j=3 Q=0
# triaddb
# Reference sequences=174 normal letters=91719965
#
#    A  C  G  T
# A  1 -3 -3 -3
# C -3  1 -3 -3
# G -3 -3  1 -3
# T -3 -3 -3  1
#
# Coordinates are 0-based.  For - strand matches, coordinates
# in the reverse complement of the 2nd sequence are used.
#
# name start alnSize strand seqSize alignment
#
# m=1 s=35
#
a score=15539 mismap=1e-10
s scaffold_7 1976237 16386 + 5881857 AGTAGTATGACAATGTTGATAAAACTTACGGTTCGGCTTCTAACGAGCTGATCTCAGCAACATAATTGCAGGGAATATAACCACGTAAGCCGCTACGTCT

[zajic]

Hello, I know that this is an old question, but may be it can help to someone using maffilter. I had the same problem and looking at the source code I figured out that maffilter is parsing sequence name and is expecting do there.
I resolved the problem by renaming sequence names so that they contain dots

sed -i -e 's/scaffold_m16_p_1/mMolMol1.p1/g' test2.maf
sed -i -e 's/scaffold_m19_p_1/mMyoMyo1.p1/g' test2.maf