SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bwa perfect match only guil Bioinformatics 4 08-30-2013 09:18 AM
Bismark and unique matches mixter Bioinformatics 3 12-12-2012 04:06 AM
Finding Perfect matches and mismatches bhargavpbk88 Bioinformatics 2 01-19-2012 07:00 AM
perfect alignment match NicoBxl Bioinformatics 3 10-07-2010 04:28 AM
Perfect match disagreement between bowtie and BLAT on human genome danielsbrewer Bioinformatics 3 03-10-2009 09:10 PM

Reply
 
Thread Tools
Old 02-05-2013, 05:17 AM   #1
yvan.wenger
Member
 
Location: Switzerland

Join Date: Aug 2009
Posts: 30
Default Bowtie not mapping (even) perfect matches ?

Hello everybody,

I am a little worried since about half of my reads do not align, although they have exact full-length matches in the my dataset.

I run bowtie with the command line:

./bowtie-0.12.9/bowtie myindex -a -S -p 32 -r ibis100.raw ibis100.sam

As the command line says, I used raw reads without quality scores as an input.

Typical sam line for a read that matches 100% the reference:

10423427 4 * 0 0 * * 0 0 GTTATTCATTCACTACTACAGCTGAGCGTGAAATTGTAAGAGATATTAAAGAGAAACTTAGTTATGTAGCCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XM:i:0

The vast majority of reads are perfect alignments when checked using blast, my understanding is that the -a option should cause them to be reported all, and still, they do not align properly.

Has anybody any thought about what could be the cause of that? I find it really weird and have not been able to find an explanation so far.

All the best,

Yvan
yvan.wenger is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:02 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO