SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie2 / Bowtie 2 gapped alignment hanshart Bioinformatics 0 03-15-2012 07:52 AM
ask for gapped (indel) alignment software polyhedron General 11 03-23-2011 03:01 AM
bfast gapped alignment Protaeus Bioinformatics 1 08-30-2010 09:33 PM
Gapped Alignment agc Bioinformatics 3 06-07-2010 09:20 AM
Gapped alignment using SOAP? MattB Bioinformatics 0 11-06-2009 09:28 PM

Reply
 
Thread Tools
Old 03-11-2013, 07:39 AM   #1
Bulak
Junior Member
 
Location: Switzerland

Join Date: Jun 2012
Posts: 3
Default bowtie2 gapped alignment

Hi, I am trying to map some short RNA-Seq reads from mouse against genome (mm10)/transcriptome sequences using bowtie2. There is a particular case which I couldn't resolve. Briefly, bowtie2 is not able to find an alignment for a read of length 33 which in fact can align against the genomic sequence with a single gap roughly in the middle of the read sequence.

HTML Code:
Query  1   ATACGTCCTCTATC-GAGGACAATATATTAAATG  33
           |||||||||||||| |||||||||||||||||||
Sbjct  64  ATACGTCCTCTATCCGAGGACAATATATTAAATG  97
When this gap is corrected by hand, then bowtie2 finds the match. To be more specific the particular sequence is from a U2 ncRNA and a tiny fastq format is attached. The second read in the same file is a faux read created by changing the ID of the first one and filling in the gap by hand.
I have tried bowtie2 with several parameters:
--very-sensitive
-L 10 -D 20 -R 20 -N 0 -i S,1,0.5
-L 10 -D 20 -R 20 -N 1 -i S,1,0.5
-L 10 -D 20 -R 20 -N 0 -i S,1,0.5 --rdg 1,1
-L 6 --score-min=C,-60,0
-L 6 --score-min=C,-100,0

Only in the last one, I started to get some horribly bad misalignments, but not the aimed alignment with one gap. Can someone explain what I am missing? Thanks for any comments/suggestions.
Attached Files
File Type: txt unmmapped.fq.txt (221 Bytes, 15 views)
Bulak is offline   Reply With Quote
Reply

Tags
bowtie2, gapped alignment

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:14 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO