
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Is this bisulfite sequencing stranded or not? biocomputer Bioinformatics 1 08-31-2015 10:16 AM
BSSim: Bisulfite sequencing simulator for next-generation sequencing. xigyou Epigenetics 0 09-27-2012 05:53 AM
Help with bisulfite sequencing aniruddha.otago Epigenetics 1 02-03-2010 07:26 AM

Thread Tools
Old 10-17-2017, 12:02 PM   #1
Location: EU

Join Date: Jun 2011
Posts: 13
Default Bisulfite sequencing question

Hi all,

A (may be) stupid question about bisulfite sequencing: Do we in general expect CpGs to be equally methylated on both strands? For example, I am looking at the processed data from this GEO entry:

It looks like the methylation levels of CpGs belonging to the same pair but at different strands are very different (compare columns 4 and 8 below), while the sequencing coverage looks good. How to interpret this?

chr2 3051114 + 35.7143 14 25 12 42.8571 7 45.4545 11 catgaccaatgaaagacgtagaaaacccaacatt
chr2 3052114 + 100 16 93.3333 15 87.5 8 88.8889 18 agctgagccatctccccggccccGACCTAGAACT
chr2 3052120 + 76.4706 17 81.25 16 55.5556 9 76.4706 17 gccatctccccggccccGACCTAGAACTCTTTAG
chr2 3052240 + 30.7692 13 27.7778 18 20 10 22.2222 9 cagttgaaagccaccacgttgatgctgggaattg
chr2 3052311 + 50 12 46.6667 15 75 12 87.5 8 cacctgagacatctctcGACCCAGGCACTGTGTT
chr2 3052400 + 90.9091 11 84.6154 13 90 10 62.5 8 ATCACTTGTCCAAACTCGAAACCGGTAATCCAGA
chr2 3052406 + 75 12 92.8571 14 90 10 100 6 TGTCCAAACTCGAAACCGGTAATCCAGAAAGCCA
chr2 3052493 + 50 8 50 12 44.4444 9 42.8571 7 TGAATGCTGTGGGCACCGGGAACCCTGCACACCT
chr2 3052712 + 80 10 85.7143 7 77.7778 9 70 10 AAGTACAGGTTGATGGCGCAGACCAGCGCCATGA
chr2 3052722 + 44.4444 9 22.2222 9 60 10 36.3636 11 TGATGGCGCAGACCAGCGCCATGATGCAGGAAGT
chr2 3052756 + 80 10 100 11 100 9 92.8571 14 GATGGCTTTGCTCAACCGGCCGTTGGCAAACTCC
__sequence is offline   Reply With Quote
Old 10-17-2017, 02:39 PM   #2
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480

Yes, most methylation is symmetric, I haven't a clue why they're always getting such large differences between strands.
dpryan is offline   Reply With Quote

5mc, bis-seq, bismark, bisulfite

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 10:44 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO