SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Average Read Coverage for 454 paired end read data lisa1102 Core Facilities 8 10-18-2011 08:40 AM
Paired end Short read data SS1234 Bioinformatics 6 06-09-2010 01:16 PM
help! what is a paired-end read? hitdavid Bioinformatics 1 01-14-2010 11:42 AM
Difference in paired-end and single-end read ? darshan Bioinformatics 1 09-30-2009 11:44 PM

Reply
 
Thread Tools
Old 10-22-2015, 02:05 PM   #61
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Then you should consider that overlap is something like:
R1-ATTGCTGTG
-----------ACACTGAAAAGT-R2
OTU is offline   Reply With Quote
Old 10-22-2015, 02:09 PM   #62
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

how you got these reads !! ??
mido1951 is offline   Reply With Quote
Old 10-22-2015, 02:21 PM   #63
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Oh, that's just an example of what paired-end pairing looks like.
OTU is offline   Reply With Quote
Old 10-22-2015, 02:30 PM   #64
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

for example:
we have a fragment of DNA: ATCGTTGAGCAGACT
we will sequence this fragment and for example after the paired end sequencing reads we have R1 and R2 with a length 6. Thus:
R1 = ATCGTT
R2 = AGTCTG (reverse complement)
so after sequencing wa have R1..... R2 (the middle part is unknown).
that's the paired end reads.
or not?
mido1951 is offline   Reply With Quote
Old 10-22-2015, 02:37 PM   #65
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

No. If you have a fragment of DNA: ATCGTTGAGCAGACT,
your R1: TAGCAA
and R2: GTCTGA
OTU is offline   Reply With Quote
Old 10-22-2015, 02:40 PM   #66
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

how make an assembly with reads (paired end: two files) .
Is it that you can make an example please?
thanks
mido1951 is offline   Reply With Quote
Old 10-22-2015, 02:42 PM   #67
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Assembly algorithm will depend whether you have a reference genome or not. Is it a metagenome sequencing?
OTU is offline   Reply With Quote
Old 10-22-2015, 02:51 PM   #68
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

no. i have illumina paired end reads. and I want to denovo assembly without a reference genome.
how the right portion of a reads overlaps with the left portion of another reads? (it was not the same sense od read)
And have you an example
mido1951 is offline   Reply With Quote
Old 10-22-2015, 03:34 PM   #69
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Left and right are not complements of each other. They match. That's how they overlap. For denovo assembly try using programs like SOAP denovo
http://soap.genomics.org.cn/soapdenovo.html, or SPADES de novo http://bioinf.spbau.ru/en/. Are your sequences from single cell? Or a metagenome?
OTU is offline   Reply With Quote
Old 10-22-2015, 03:39 PM   #70
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

I know the operation of assembly programs.
but I basically want to understand the overlap between the paired end reads (the two files).
i have single cell not meta genome.
have you an example?
mido1951 is offline   Reply With Quote
Old 10-22-2015, 03:40 PM   #71
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

what example are you looking for?
OTU is offline   Reply With Quote
Old 10-22-2015, 03:56 PM   #72
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

for example we have two fragments.
S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT

we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
S1:R1: ATCGTTGAGCA
S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
S2:R1:TGAGCAGACTT
S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.

how to make assembly in this case?
mido1951 is offline   Reply With Quote
Old 10-22-2015, 03:59 PM   #73
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

R2 reads are not in a form of reverse complement.
OTU is offline   Reply With Quote
Old 10-22-2015, 04:05 PM   #74
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

Quote:
Originally Posted by OTU View Post
R2 reads are not in a form of reverse complement.
illumina read the fragment from the right.
so if S1 is read from right, is that we take the reverse complement fragment or fragment from the right?
In this case R2 is what?
mido1951 is offline   Reply With Quote
Old 10-26-2015, 09:30 AM   #75
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Sorry, you are right. I meant something different.
Your previous post depicts the assembly process correctly.
What I don't understand is what exactly is your question then?
OTU is offline   Reply With Quote
Old 10-26-2015, 10:14 AM   #76
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

Code:
for example we have two fragments.
S1: ATCGTTGAGCAGACT and S2: TGAGCAGACTTAAGTAGTTTT they have an overlap zone"TGAGCAGACT". so the consensus is:ATCGTTGAGCAGACTTAAGTAGTTTT

we sequenced this two fragments S1 and S2 in paired end reads R1 and R2.
S1:R1: ATCGTTGAGCA
S1:R2: AGTCTGCTCAA (illumina read the fragment in the other way so I think that to write in reverse complement. correct me if I'm wrong)
S2:R1:TGAGCAGACTT
S2:R2:AAAACTACTTA (reverse complement)I think this way is built the R2.

how to make assembly in this case?
I speak of here. How the assembly in this case?
in both files (paired end), is what we must do the merging of the two files?
mido1951 is offline   Reply With Quote
Old 10-26-2015, 10:16 AM   #77
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

You realize that you are not doing this manually, right? You usually use a program, which creates overlapping/merging reads and gives you the contig.
OTU is offline   Reply With Quote
Old 10-26-2015, 10:22 AM   #78
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

Use Panda or Flash (or probably a number of other programs) to do merging.
westerman is offline   Reply With Quote
Old 10-26-2015, 10:28 AM   #79
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

yes I know.
I'm talking of phase before getting contigs.
you know to make an assembly of reads that it must overlap.
In the case of paired end reads, how to find overlaps between the two files?
we F1.fq that contains reads RX.1 and F2.fq that contains reads RX.2.
how to find the overlap between these reads? is what we should do a merging between RX.1 and RX.2?
So the merging is necessary?
thanks
mido1951 is offline   Reply With Quote
Old 10-26-2015, 10:39 AM   #80
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,077
Default

@Rick/@OTU: In order to avoid a re-hash of things that have been already discussed in other threads I am posting two below.

http://seqanswers.com/forums/showthread.php?t=63703
http://seqanswers.com/forums/showthread.php?t=63571

@mido1951 is either mis-understanding some basic concepts about sequencing/assembly or I am not able to understand what @mid1951 wants to know.
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:15 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO