SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to extract mapped and unmapped raw reads from bwa's sam file ? vaibhavvsk Bioinformatics 11 02-07-2013 09:01 AM
bitwise flag in SAM file win804 Bioinformatics 25 02-04-2013 08:56 PM
bitwise flag in sam format and others aurelielaugraud Bioinformatics 48 11-24-2012 11:01 PM
mutiple mapped reads FLAG/TAG in bwa alignment data totalnew Bioinformatics 0 05-06-2011 10:21 AM
SAM flag field and removing unmapped reads from BFAST output aiden Bioinformatics 3 05-27-2010 06:10 PM

Reply
 
Thread Tools
Old 08-29-2011, 01:03 PM   #1
wenhuang
Member
 
Location: Raleigh, NC

Join Date: Feb 2010
Posts: 30
Default BWA output bitwise flag for mapped/unmapped reads

Hi everybody,

I have a question on a strange alignment I got with BWA (0.5.9). I have come up with a minimal test sequence



@5:84:16665:11131:Y
AGAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAAGAGG
+
fdffffff]cffff[aa_]aPVVSYQaa\afc`cffcfffdWf`fadaWd`]aZ^TV]X_TaSWaQ[Z



which apparently can map to the drosophila genome (dm3/R5).

and has the following SAM output




5:84:16665:11131:Y 4 chr2LHet 368806 11 68M * 0 0 AGAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAACAGAGAAGAGG GEGGGGGG>DGGGG<BB@>B1774:2BB=BGDADGGDGGGE8GAGBEB8EA>B;?57>9@5B48B2<; XT:A:U NM:i:1 X0:i:1 X1:i:15 XM:i:1 XO:i:0 XG:i:0 MD:Z:1C66




what baffles me is the bitwise flag = 4, which indicates that this read is unmapped.

Anybody has any idea what is happening here?

Thank you,

Wen
wenhuang is offline   Reply With Quote
Old 08-29-2011, 03:54 PM   #2
wenhuang
Member
 
Location: Raleigh, NC

Join Date: Feb 2010
Posts: 30
Default

I think I have found the answer in this post

http://seqanswers.com/forums/showthread.php?t=12767

It turns out the alignment was at the end of the chromosome and contained a overhang which apparently mapped to the next chromosome.
wenhuang is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:53 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO