SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Pacific Biosciences



Similar Threads
Thread Thread Starter Forum Replies Last Post
Starting to use BWA-SW miguelangel Bioinformatics 5 12-13-2012 05:19 AM
help regarding starting concentration of dna balaji_chattopadhyay Illumina/Solexa 1 06-21-2012 09:35 AM
5500xl starting questions rtpon SOLiD 5 03-19-2012 12:29 AM
How much starting material? hambone 454 Pyrosequencing 1 01-20-2012 05:38 AM
concentration of my starting material? seqgirl123 Illumina/Solexa 6 07-28-2009 06:19 PM

Reply
 
Thread Tools
Old 10-17-2013, 09:08 AM   #1
julio514
Member
 
Location: Montreal, QC

Join Date: May 2011
Posts: 12
Default starting smrtpipe with .cmp.h5

Dear PacBio Gods,
I'd like to know how (or if it is possible) to start a smrtpipe job with .cmp.h5 instead of .bas.h5 files? Say for instance I sucessfully ran a realigning job with smrtpipe which generates a couple of files of which a .cmp.5. Then I'd like to run the RS_Modification_and_Motif_Analysis.1.xml protocol, but since .cmp.h5 have already been generated I thought it would be nice to start directly with the .cmp.h5.

Also I know I could just add the proper Motif detection prototols in my realigning xml file, so everything could be run in one step, but for some reasons I want to keep them separate.
Cheers,
julio514 is offline   Reply With Quote
Old 10-18-2013, 10:40 AM   #2
rhall
Senior Member
 
Location: San Francisco

Join Date: Aug 2012
Posts: 322
Default

Unfortunately cmp.h5 files cannot be used as input to SMRT Pipe. It is possible to run the Modification and Motif analysis manually:
Code:
ipdSummary.py -h
Code:
motifMaker.sh
But the full SMRT Pipe generated report will be missing. If you wan to run the complete workflow I would suggest running one complete job starting from the bas.h5 through SMRT Pipe then checking out the workflow graph:
<job dir>/workflow/Workflow.summary.html to see what exactly is ran, you can then find the actual command lines:
<job_dir>/workflow/P_ModificationDetection
<job_dir>/workflow/P_MotifFinder
rhall is offline   Reply With Quote
Old 11-08-2013, 06:08 AM   #3
julio514
Member
 
Location: Montreal, QC

Join Date: May 2011
Posts: 12
Default

Thanks for the suggestion rhall, that's what I ended up doing - and I'm now running each steps separately based on the log files. Cheers,
julio514 is offline   Reply With Quote
Old 11-03-2015, 09:45 AM   #4
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

Dear pacbio God Almighty,
Please, let me continue this post..... I'm trying to run MotifMaker; in the begining looks good:
Code:
(smrtanalysis-2.3.0) [resources]$ motifMaker.sh 
Usage: MotifMaker [options] [command] [command options]
  Options:
    -h, --help   
                 Default: false
  Commands:
....
but when I place any inputs:

Code:
motifMaker.sh find -f Geobacter_metallireducens_gDNA.fasta -g modifications.gff.gz -o output.csv
I get:

Code:
Exception in thread "main" java.lang.reflect.InvocationTargetException
	at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
	at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
	at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
	at java.lang.reflect.Method.invoke(Method.java:601)
	at com.simontuffs.onejar.Boot.run(Boot.java:340)
	at com.simontuffs.onejar.Boot.main(Boot.java:166)
Caused by: java.util.NoSuchElementException: key not found: ref000001
	at scala.collection.MapLike$class.default(MapLike.scala:225)
	at scala.collection.immutable.Map$Map1.default(Map.scala:107)
	at scala.collection.MapLike$class.apply(MapLike.scala:135)
	at scala.collection.immutable.Map$Map1.apply(Map.scala:107)
	at com.pacbio.basemods.Reader$.parseLine$1(MotifMixture.scala:263)
	at com.pacbio.basemods.Reader$$anonfun$loadModificationsFromGff$1.apply(MotifMixture.scala:292)
	at com.pacbio.basemods.Reader$$anonfun$loadModificationsFromGff$1.apply(MotifMixture.scala:292)
	at scala.collection.Iterator$$anon$19.next(Iterator.scala:401)
	at scala.collection.Iterator$$anon$19.next(Iterator.scala:401)
	at scala.collection.TraversableOnce$FlattenOps$$anon$1.hasNext(TraversableOnce.scala:391)
	at scala.collection.Iterator$$anon$22.hasNext(Iterator.scala:457)
	at scala.collection.Iterator$class.foreach(Iterator.scala:772)
	at scala.collection.Iterator$$anon$22.foreach(Iterator.scala:451)
	at scala.collection.generic.Growable$class.$plus$plus$eq(Growable.scala:48)
	at scala.collection.mutable.ArrayBuffer.$plus$plus$eq(ArrayBuffer.scala:102)
	at scala.collection.TraversableOnce$class.toBuffer(TraversableOnce.scala:250)
	at scala.collection.Iterator$$anon$22.toBuffer(Iterator.scala:451)
	at scala.collection.TraversableOnce$class.toArray(TraversableOnce.scala:237)
	at scala.collection.Iterator$$anon$22.toArray(Iterator.scala:451)
	at com.pacbio.basemods.Program$.loadModificationsGff(Program.scala:602)
	at com.pacbio.basemods.Program$.runMotifReport(Program.scala:796)
	at com.pacbio.basemods.Program$.main(Program.scala:929)
	at com.pacbio.basemods.Program.main(Program.scala)
	... 6 more
Any idea what I'm doing wrong will be appreciated. Thanks

PD. I'll sacrifice my bacteria strains in your honor
cascoamarillo is offline   Reply With Quote
Old 11-04-2015, 11:49 AM   #5
rhall
Senior Member
 
Location: San Francisco

Join Date: Aug 2012
Posts: 322
Default

Looks like a mismatch between the fasta header names used in the gff file and those in the fasta file. Is the fasta file from the imported reference used to generate the gff?
rhall is offline   Reply With Quote
Old 11-04-2015, 03:11 PM   #6
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

It doesn't look like that. I picked the files from motifMaker-master
https://github.com/PacificBiosciences/MotifMaker
to use as test
Code:
motifMaker.sh -f src/test/resources/Geobacter_metallireducens_gDNA.fasta -g src/test/resources/modifications.gff.gz -o src/test/resources/output.csv
the head in the files:
Geobacter_metallireducens_gDNA.fasta
Code:
>ref000001|G.metallireducens_gDNA
modifications.gff.gz
Code:
##gff-version 3
##source kineticModificationDetector 0.1
##source-commandline /mnt/secondary/Smrtanalysis/opt/smrtanalysis/analysis/bin/ipdSummary.py --summary_h5 /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/040/040017/data/temp_kinetics.h5 --gff /scratch/tmp6fBZys.gff --csv /scratch/tmpzLX0jG.csv --reference /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/references/Geobacter_metallireducens_gDNA /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/040/040017/data/aligned_reads.cmp.h5
##sequence-header ref000001 G.metallireducens_gDNA
ref000001	kinModCall	modified_base	42	42	36	-	.	IPDRatio=1.89;context=CTTGACAGACAATGGTTGCTGTGATTAAAGATACTCTCTTT;coverage=106
Took out
Code:
|G.metallireducens_gDNA
but still with exceptions, though a little different this time:
Code:
smrtanalysis-2.3.0) [frodriguez@minnie MotifMaker-master]$ motifMaker.sh -f src/test/resources/Geobacter_metallireducens_gDNA.fasta -g src/test/resources/modifications.gff.gz -o src/test/resources/output.csv 
Exception in thread "main" java.lang.reflect.InvocationTargetException
	at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
	at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
	at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
	at java.lang.reflect.Method.invoke(Method.java:601)
	at com.simontuffs.onejar.Boot.run(Boot.java:340)
	at com.simontuffs.onejar.Boot.main(Boot.java:166)
Caused by: com.beust.jcommander.ParameterException: Unknown option: -f
	at com.beust.jcommander.JCommander.parseValues(JCommander.java:723)
	at com.beust.jcommander.JCommander.parse(JCommander.java:275)
	at com.beust.jcommander.JCommander.parse(JCommander.java:258)
	at com.pacbio.basemods.Program$.main(Program.scala:915)
	at com.pacbio.basemods.Program.main(Program.scala)
	... 6 more
cascoamarillo is offline   Reply With Quote
Old 11-04-2015, 03:53 PM   #7
rhall
Senior Member
 
Location: San Francisco

Join Date: Aug 2012
Posts: 322
Default

Looks like an error related to the passing of variables to the .sh rather than running the jar directly. Try:
Code:
motifMaker.sh find --gff modifications.gff.gz --fasta reference.fasta --output motif_summary.csv
rhall is offline   Reply With Quote
Old 11-06-2015, 02:44 PM   #8
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

Yep, it works! Thanks
cascoamarillo is offline   Reply With Quote
Old 11-06-2015, 02:51 PM   #9
cascoamarillo
Senior Member
 
Location: MA

Join Date: Oct 2010
Posts: 160
Default

Sorry, but one more question regarding MotifMaker analysis. So it's been created to identify motifs associated with DNA modification in prokaryotic genomes, though it's not clear (for me) if the algorithm use any motif database (prokaryote) in order to pull them out.
Let me rephrase the question: would it be appropriate to use MotifMaker with eukaryote genomes?
Thanks
cascoamarillo is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:45 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO