SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
TopHat file.bam file.bed join Trudy Bioinformatics 1 05-21-2013 11:59 AM
Rsamtools Bam file reading error dab32 Bioinformatics 0 11-07-2011 03:21 AM
Cufflinks crashes on BAM output from TopHat Sherry Bioinformatics 0 02-07-2011 07:04 AM
bam output file to psl file fahim Genomic Resequencing 1 12-26-2010 12:27 PM
Filter paired end BAM file based on iSize Leif Bergsagel Bioinformatics 2 12-16-2010 11:50 AM

Reply
 
Thread Tools
Old 11-22-2010, 06:13 AM   #1
ghbore
Junior Member
 
Location: Beijing, P. R. China

Join Date: Nov 2010
Posts: 2
Default Tophat output BAM file ISIZE Error

Dear All,
I am trying to map strand-specific pair-end reads using Tophat v1.1.4, but in the result BAM file 'ISIZE' or 'TLEN' field is identical to ZERO all the time. Take some hits for example:
A8054YABXX:8:1:17161:19551#ATCACGAT 163 chr1 395709 255 100M = 395803 0 GCGCCAGTCGCAGAGGAAGATGGCGTCGCGAAGGCTGGGGTCGTTTCTGCGCGGGCTGCCGGCGCTGCTACTGCTGATGCTGTTCTTGCTTGGGCCCTGG GGGGGGGGGGGGGGGGBGGFDGGGGDFFFFDFGGGGGGGGAFFDFEEEEEGGGFGGGGDGGG?E?EFDAAEC=CAEBBDCEEAE=ABA?########### NM:i:0 NH:i:1 XS:A:+
A8054YABXX:8:4:14320:96976#ATCACGAT 163 chr1 395709 255 100M = 395803 0 GCGCCAGTCGCAGAGGAAGATGGCGTCGCGAAGGCTGGGGTCGTTTCTGCGCGGGCTGCCGGCGCTGCTACTGCTGATGCTGTTCTTGCTTGGGCCCCGG GGGGGGGEGGGGGDGGGFGGGGGFGAFFFFFFDFFFEGGGBEEAEFFFFFGGGEGG?GDG?DDDBBA?=CEBCAECB:A::??C5?B############# NM:i:1 NH:i:1 XS:A:+

The Run Command Line is:
Code:
tophat-1.1.4.Linux_x86_64/tophat --mate-inner-dist 100 --min-anchor-length 8 --splice-mismatches 0 --max-multihits 100 --output-dir tophat-114_out --num-threads 6 --solexa1.3-quals --coverage-search --microexon-search --library-type fr-firststrand --segment-mismatches 2 --segment-length 25 bowtie_index L1_1.fq L1_2.fq
I do not know what's wrong. And any help would be appreciated. Thanks ahead!
ghbore is offline   Reply With Quote
Old 11-22-2010, 06:42 AM   #2
ghbore
Junior Member
 
Location: Beijing, P. R. China

Join Date: Nov 2010
Posts: 2
Default

What's more, the 'MAPQ' field is also non-informative, because the statistic result is (do '|cut -f5 |sort -n |uniq -c'):
64581 0
256873 1
1525878 3
23635482 255
ghbore is offline   Reply With Quote
Old 11-28-2010, 11:49 PM   #3
chenjy
Member
 
Location: China

Join Date: Oct 2010
Posts: 22
Default

i'd like to lend a hand, however, i encountered the same problem~~~
chenjy is offline   Reply With Quote
Reply

Tags
bam, isize, rnaseq, strand-specific, tophat

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO