I want to remove 3' adapter of small rna sequencing data generated from illumina.
first, I try mapper.pl within mirdeep2 toolkit. but soon i found it can't remove the unclipped sequence.
so I try fastx_clipper, the result seems pretty good, but when I use compare software to see if everything goes well. I found problem. the adapter I provided is 5' TGGAATTCTCGGGTGCCAAGG 3'. but in the result, besides this adapter, another sequence 5' TAGAATGCTCGCCTTGGAA 3' also removed in a lot of reads. anybody know whats going on with the result?
the command I used is :fastx_clipper -a TGGAATTCTCGGGTGCCAAGG -l 18 -c -v -i ./VF_test_raw.fa -o VF_test_clipped_fastx1.fa
first, I try mapper.pl within mirdeep2 toolkit. but soon i found it can't remove the unclipped sequence.
so I try fastx_clipper, the result seems pretty good, but when I use compare software to see if everything goes well. I found problem. the adapter I provided is 5' TGGAATTCTCGGGTGCCAAGG 3'. but in the result, besides this adapter, another sequence 5' TAGAATGCTCGCCTTGGAA 3' also removed in a lot of reads. anybody know whats going on with the result?
the command I used is :fastx_clipper -a TGGAATTCTCGGGTGCCAAGG -l 18 -c -v -i ./VF_test_raw.fa -o VF_test_clipped_fastx1.fa