Novoalign and mismatches

[StephaniePi83]

Dear all,

I'am analyzing small RNA seq data (23-30 nt long RNA) and I need to map them allowing up to 4 mismatches.
I decided to use novoalign.

I take a read as an example, and i try to map it with up to 4 mismatches on the reference.

here is the original sequence which align to the reference with 3 mismatches
>RNA_1
ATCAGACACTTCATAACACATTTAATA

I use the following command line :

novoalign -d I_DM -f test.fasta -g 200 -t 90 -r All -F FA

and get the following result :

>dme_pi_605890_24_5	S	ATCAGACACTTCATAACACATTTAATA	.	U	90	38	>I_DM	I	Drosophila	1870	F	.	.	.	2C>T 11C>T 26C>T

Then, i change the sequence of the RNA, in order to have 4 mismatches :

>RNA_1_bis
ATCAGACACTTCATAACACATTTAATC

And i use the following command line :

novoalign -d I_DM -f test.fasta -g 200 -t 120 -r All -F FA

But i have no result, i try with -t option up to 300, but no result, any idea ?

Thanks in advance for your help !