SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SNP at every chromosome position Waqasuddin Khan SOLiD 1 09-10-2015 09:01 PM
Paralleling Control-FREEC chromosome by chromosome lethalfang Bioinformatics 0 05-14-2014 12:17 PM
draw figure with genomic position of miRNA on each chromosome lran2008 Bioinformatics 0 08-26-2013 01:14 PM
the hg19 chromosome size in ncbi is different with UCSC? tintin306 Bioinformatics 1 04-10-2012 01:18 AM
chromosome match position in eland files litd General 0 03-02-2010 01:54 PM

Reply
 
Thread Tools
Old 07-26-2016, 08:58 PM   #1
DNAmethylome
Member
 
Location: usa

Join Date: Oct 2012
Posts: 13
Default Tophat chromosome position greater than chromosome size

I use tophat to map the rna-seq reads (paired-end). It seems that some of the reads in the .sam do not make sense. Please see some examples below:

Example line 1:
NB500923:20:H7WCJBGXX:1:12109:13961:14748 385 chr1 11646 3 151M chr22 114359002 0 CTTTTGGATTTTTGCCAGTCTAACAGGTGAAGCCCTGGAGATTCTTATTAGTGATTTGGGCTGGGGCCTGGCCATGTGTATTTTTTTAAATTTCCACTGATGATTTTGCTGCATGGCCGGTGTTGAGAATGACTGCGCAAATTTGCCGGAT AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEE/AEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEA/EAA<EEEEEEAEA/<AEE XA:i:0 MD:Z:151 NM:i:0 NH:i:2 CC:Z:chr15 CP:i:102519374 HI:i:0

In the above line, it says the start position of the mate on chr22 is 114359002, however, the size of the chr22 is only 51304566

Example line 2:
NB500923:20:H7WCJBGXX:1:23107:14442:20318 323 chr1 11696 0 151M chrUn_GL000249 155257832 0 GTGATTTGGGCTGGGGCCTGGCCATGTGTATTTTTTTAAATTTCCACTGATGATTTTGCTGCATGGCCGGTGTTGAGAATGACTGTGCAAATTTGCCGGATTTCCTTCGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCAGCACCGGGT AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEAEEEEEAEEEEEEE<EEEEEEEEEEEEEEEAAEEA<EEEEEE XA:i:2 MD:Z:85C21T43 NM:i:2 NH:i:8 CC:Z:= CP:i:11696 HI:i:4

It says the start position of the mate on chrUn_GL000249 is 155257832, however, the total size of chrUn_GL000249 is only 38502.

Can anyone tell how this could happen? and how to fix the file?

Thanks,
DNAmethylome is offline   Reply With Quote
Old 07-27-2016, 06:17 AM   #2
DNAmethylome
Member
 
Location: usa

Join Date: Oct 2012
Posts: 13
Default

Can anyone help?
DNAmethylome is offline   Reply With Quote
Old 07-28-2016, 12:39 AM   #3
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,479
Default

Looks like this is a bug in the version of tophat2 that you're using. If you're using the most recent version, then please report this to the authors so they can fix it.
dpryan is offline   Reply With Quote
Reply

Tags
mate, rna, tophat

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:43 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO