SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
samtools mpileup floating point error Hkins552 Bioinformatics 12 03-02-2014 08:13 AM
samtools tview produces "Floating point exception" on big file? pmaugeri Bioinformatics 2 10-28-2011 08:06 AM
SOAPdenovo -error robelb4 Bioinformatics 0 08-05-2011 11:39 AM
error from SOAPdenovo shuang Bioinformatics 6 07-15-2011 07:43 AM
MAQ - segmentation error jyli Bioinformatics 0 02-03-2009 09:54 AM

Reply
 
Thread Tools
Old 11-21-2011, 09:35 AM   #1
andyding
Junior Member
 
Location: Houston/Shanghai

Join Date: Aug 2011
Posts: 7
Question Problem Encountered When Using SOAPdenovo: Floating Point / Segmentation Error

Hi, Dear Colleagues:
I'm a student from Fudan University, and is currently trying to use SOAPdenovo to run de novo assemble on human mitochondrial genome sequencing data. These data are either downloaded from the 1000Genome Project website (which is sequenced by Illumina or SOLiD sequencers) or sequenced by our lab using Illumina HiSeq2000 sequencers. The coverage of reads are low to moderate, from 20x to 50x.
The configuration of computer I used to run SOAPdenovo is as follows:
Intel Core i7 Quad 2.3GHz, 8GB of RAM, 750GB HDD, Mac OS X 10.7.2 and running SOAPdenovo 1.05 ver 63.
The problem I encountering is when I tried to using SOAPdenovo to construct scaffolds. I've tested different kmer values, from 13 (the minimum allowance of SOAPdenovo) to 43 (the maximum I can run on this computer), yet all of the tests have returned a "Segmentation fault: 11" or a "Floating point exception: 8" error.
Furthermore, I found the contig constructed by SOAPdenovo is significantly smaller thant the 454 de novo assembler. The biggest contig constructed by SOAPdenovo is only about 600bp long, yet the biggest contig constructed by 454 de novo assembler is more than 7,000bp.
To help you to analyze the problem, I've attached the configuration file, as well as the sample reads I've used, at the end of this post.
Your kind reply will be quite appreciated.

Thanks.


Configuration File:
max_rd_len=100
[LIB]
avg_ins=500
reverse_seq=0
asm_flags=3
rank=1
q1=/Users/AndyDing/Server/data/111121/NA19308_f.fq
q2=/Users/AndyDing/Server/data/111121/NA19308_r.fq

Sample Reads:
@SRR042435.101073000/1
ACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCC
+
><5@A?>@B;A<B=>@<@@A<A<<<@@BC@B<=A<@;A<4<=;;;?797I
@SRR042435.101149159/1
GATGGATCACANNTCTATCACCCTATTAACCACTCACNNGAGCTCTNNAT
+
>AA?=AB:A<A!!?<A@B<A<=>A@AC?B<<A;@<@<!!>A;:?;?!!5I

Last edited by andyding; 11-22-2011 at 03:33 AM.
andyding is offline   Reply With Quote
Reply

Tags
de novo assembly, illumina, soapdenovo

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:15 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO