Hi,
I'm getting up to speed with Marcel Martin's cutadapt for removing adapter sequences from Illumina libraries.
I'd appreciate some expert input on what values might be reasonable for the -O (--overlap) parameter. As explained in the excellent help pages, this parameter defines the minumum overlap between the input adapter sequence and read sequences:
My initial run has used the default. I get trim data like this:
I can see this is not sensible.
With length=3 I get 95613 reads removed from my library; a good proportion of these must be spurious (i.e. by chance).
With length=33 I get 47317 reads removed. These have a better chance of not being spurious.
Somewhere between the boundaries here (3 .. 33) there must be a 'sensible' value for --offset. How do I identify it? Using what rationale? I could just opt for 33, the length of the adapter. But that would discount the probability that those of length 32 are also genuine (this library has an abrupt shift from 32 with 351 reads to 33 with the 47317, but not all my libraries look like this).
How might I go about this??
TIA
mgg
I'm getting up to speed with Marcel Martin's cutadapt for removing adapter sequences from Illumina libraries.
I'd appreciate some expert input on what values might be reasonable for the -O (--overlap) parameter. As explained in the excellent help pages, this parameter defines the minumum overlap between the input adapter sequence and read sequences:
Code:
-O LENGTH, --overlap=LENGTH Minimum overlap length. If the overlap between the read and the adapter is shorter than LENGTH, the read is not modified.This reduces the no. of bases trimmed purely due to short random adapter matches (default: 3).
Code:
Adapter 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC', length 33, was trimmed 205113 times. Histogram of adapter lengths length count 3 95613 4 12912 5 5869 6 4173 7 3809 8 3323 9 3183 10 2934 11 2938 12 2464 13 2213 14 2041 15 1803 16 1650 17 1489 18 1334 19 1269 20 1147 21 1031 22 909 23 859 24 819 25 701 26 656 27 536 28 528 29 488 30 386 31 368 32 351 33 47317
With length=3 I get 95613 reads removed from my library; a good proportion of these must be spurious (i.e. by chance).
With length=33 I get 47317 reads removed. These have a better chance of not being spurious.
Somewhere between the boundaries here (3 .. 33) there must be a 'sensible' value for --offset. How do I identify it? Using what rationale? I could just opt for 33, the length of the adapter. But that would discount the probability that those of length 32 are also genuine (this library has an abrupt shift from 32 with 351 reads to 33 with the 47317, but not all my libraries look like this).
How might I go about this??
TIA
mgg
Comment