SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Compatibility of QIAseq FX DNA library prep kit for Illumina miseq djung Illumina/Solexa 2 06-15-2019 11:10 AM
Unable to do library amplification using the new Nextera DNA Flex Library Prep kit Rosmano Sample Prep / Library Generation 1 04-03-2019 03:04 AM
Adapters for Nextera Mate Pair Library Prep Kit lu_Ste Illumina/Solexa 1 10-10-2018 10:30 PM
QIAseq 1-Step Amplicon Library kit-reviews? Buckethead84 Sample Prep / Library Generation 1 09-09-2017 03:28 AM
which library kit; are adapters on Illumina PCR free LT kit biotinylated ? Lovro Sample Prep / Library Generation 0 06-08-2016 05:28 AM

Reply
 
Thread Tools
Old 10-23-2019, 05:31 AM   #1
ciemanek
Junior Member
 
Location: Cracov, PL

Join Date: Jul 2019
Posts: 5
Default QIAseq FX DNA Library Kit adapters for trimming

Can anyone point me to the sequences of QIAseq FX DNA Library Kit for adapters trimming in preprocessing? Illumina has exact sequences for trimming included in their manual, but I can't seem to find the same information in Qiagen's resources. Any suggestions on where to find them?
ciemanek is offline   Reply With Quote
Old 10-23-2019, 05:42 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,992
Default

Do a google search with "QIAseq FX DNA". Second link in that search should be a PDF file with title "QIAGENŽ QIAseq FX DNA Library Kit Handbook". Check Appendix C in that file for sequences.

Addendum : Those are just index/barcode sequences.

Last edited by GenoMax; 10-23-2019 at 05:48 AM.
GenoMax is offline   Reply With Quote
Old 10-28-2019, 02:19 AM   #3
ciemanek
Junior Member
 
Location: Cracov, PL

Join Date: Jul 2019
Posts: 5
Default

Thank you - this is a piece of information I have already: I succesfully demultiplexed my samples and now want to run QC and preprocessing, so I would need sequences of adapters to trim. Illumina provides adapters sequences in their manual (like here) and I can't find a piece of corresponding information for Qiagen.
ciemanek is offline   Reply With Quote
Old 10-29-2019, 12:57 AM   #4
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,230
Default

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.
nucacidhunter is offline   Reply With Quote
Old 10-29-2019, 02:19 AM   #5
ciemanek
Junior Member
 
Location: Cracov, PL

Join Date: Jul 2019
Posts: 5
Default

Thanks a lot - I just ran FastQC on my samples and it indeed indicated that Illumina adapters are present. However, it's not clear to me which Illumina adapters sequences should I use for trimming - would it be ie TruSeq Universal Adapter or some others? How can I determine that? Or is it a piece of information that my lab should be able to provide me with?

I tried to run BBmerge to determine adapters sequences but it didn't seem very informative (produced mostly N's).
ciemanek is offline   Reply With Quote
Old 10-29-2019, 04:14 AM   #6
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,992
Default

You may not have any adapters present if your inserts were of a good size and there was no read-through.

BBMap suite provides an adapters.fa file in the "resources" directory. You can use it to scan your sequences using bbduk.sh. It contains adapter sequences for many commonly used library kits.
GenoMax is offline   Reply With Quote
Old 10-29-2019, 04:22 AM   #7
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,230
Default

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
nucacidhunter is offline   Reply With Quote
Old 10-29-2019, 04:44 AM   #8
ciemanek
Junior Member
 
Location: Cracov, PL

Join Date: Jul 2019
Posts: 5
Default

Thanks a lot!
ciemanek is offline   Reply With Quote
Reply

Tags
adapters, preprocessing, qiagen, quality control, trimming

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO