Dear All,
I am working with SMARTer ultra low RNA kit and TruSeq libraries for Illumina sequencing. I have sequenced my paired-end libraries in GAIIx (reads of 36 nucleotides) and some of them in Hiseq2000 (reads of 100 nucleotides).
I analyzed the quality of the RNA-seq data and I found overrepresented some sequences that correspond to the primers used for the Kit (that are 30bp long), this sequences are present in 25% of the total number of reads (for example one of them: AGCAGTGGTATCAACGCAGAGTACATGGGATGGCA).
Does somebody have a similar issue???.
I am planing to remove these sequences from the data (using the tools to remove adapters FASTQC or FASTX-toolkit), but for the RNAseq of 36bp I will loss all the reads that contents this sequecence. I will use Tophat to map the reads after remove the adaptor and I don't know If there is a problem to run this program when the fastq files from left and rigth (R1 and R2) doesn't have the same number of reads. Anyone have an idea???
TEFA
I am working with SMARTer ultra low RNA kit and TruSeq libraries for Illumina sequencing. I have sequenced my paired-end libraries in GAIIx (reads of 36 nucleotides) and some of them in Hiseq2000 (reads of 100 nucleotides).
I analyzed the quality of the RNA-seq data and I found overrepresented some sequences that correspond to the primers used for the Kit (that are 30bp long), this sequences are present in 25% of the total number of reads (for example one of them: AGCAGTGGTATCAACGCAGAGTACATGGGATGGCA).
Does somebody have a similar issue???.
I am planing to remove these sequences from the data (using the tools to remove adapters FASTQC or FASTX-toolkit), but for the RNAseq of 36bp I will loss all the reads that contents this sequecence. I will use Tophat to map the reads after remove the adaptor and I don't know If there is a problem to run this program when the fastq files from left and rigth (R1 and R2) doesn't have the same number of reads. Anyone have an idea???
TEFA
Comment