SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to convert from sff to fasta or fastq shuang Bioinformatics 12 05-15-2014 08:09 AM
Convert fastq from NCBI SRA to fasta and qual? kmkocot Bioinformatics 7 10-09-2012 09:15 AM
Bioperl Script to convert fasta to fq Lizex Bioinformatics 0 01-26-2012 10:21 PM
MAQ-convert fasta to fastq rururara Bioinformatics 0 12-07-2011 11:06 PM
Convert Maq's out put to fasta/fastq? bea Bioinformatics 5 06-04-2009 01:18 AM

Reply
 
Thread Tools
Old 10-30-2011, 06:09 AM   #1
jomaco
Member
 
Location: Sheffield

Join Date: Oct 2011
Posts: 26
Default Convert FASTA to FASTAQ

Hi

I need to map small RNA sequences onto a genome using BWA.

The read file (reads.fa) is in the following format:

>EMUNAOL01D19UY length 23 duplications 0
CGTCTTGGTTTGTCTAAAGGGGC
>EMUNAOL01EK9BY length 24 duplications 0
TGGTGGAGGCCCGCAGCGATACTG
>EMUNAOL02GZHTT length 24 duplications 0
GGGCAAAAGTACAAAGTTCATGTG
>EMUNAOL02IQUC1 length 24 duplications 0
AGAAATGTTGCTACATAAATTGGA

How can I convert this file to a FASTAQ file (reads.fastq) suitable for BWA?

I tried maq but I couldn't get it to work - it just produced a file of 0 bytes - so i'm not sure if it's suitable for what i'm trying to do. Is there another program might be useful?

Thanks

Jon

Last edited by jomaco; 10-30-2011 at 06:15 AM.
jomaco is offline   Reply With Quote
Old 10-30-2011, 06:17 AM   #2
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

BWA accepts reads in the fasta format.
lh3 is offline   Reply With Quote
Old 10-30-2011, 07:41 AM   #3
jomaco
Member
 
Location: Sheffield

Join Date: Oct 2011
Posts: 26
Default

Sorry. You're right it does. Someone who asked me to run the alignment told me it was required to convert the read file to fastaq format. Perhaps I should not be so trustful next time!

I have now managed to get the alignment to run. Thanks for your reply
jomaco is offline   Reply With Quote
Old 10-31-2011, 08:46 AM   #4
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

What's this "FASTAQ" format? Do you mean "FASTQ"?
maubp is offline   Reply With Quote
Old 10-31-2011, 09:53 AM   #5
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

I believe "FASTAQ" is a typo, but actually fasta+fastq is really a fastaq format. You can mix fasta and fastq records in one file with no problem. A multi-line fastq parser can be trivially modified to parse such a file. This is basically what my fastq/fasta parser is doing. To most of my recent programs (maq excluded), fasta and fastq are the same format.
lh3 is offline   Reply With Quote
Old 10-31-2011, 10:00 AM   #6
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Mixing FASTA and FASTQ into one file... that strikes me as a strange and dangerous idea, although I can see uses for it (combining raw read datasets of different types into one file for alignment).
maubp is offline   Reply With Quote
Old 10-31-2011, 10:14 AM   #7
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

I am not saying this is a good format. I am saying that there should really be one parser instead of two.
lh3 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:14 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO