Hi Everyone,
Recently I have aligned my sequencing results using BWA and get the aligned result in SAM format.
My sequence is a single end read and therefore I would expect the bitwise flag (second field) in the SAM format contains only 0, 4, 16 (correct me if i m wrong).
However, I notice one aligned result with strange value:
id1 20 chrX 154913749 25 36M * 0 0 TGCGGTCCAACCCTAACCCTAACCCTAACCCTAACC SVVVVV[[[[[[[[[[Z[Z[[[[ZZ[[[[[Z[[[[Z XT:A:U NM:i:2X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:2T4T28
I cannot explain why there is a bitwise flag 20 in the second field. I expect it to come from 4+16, however, since it is mapped in reverse strand (give 16), then why there is 4 (which means unmapped) contribute to the bitwise flag?
Thank you very much for the help.
Recently I have aligned my sequencing results using BWA and get the aligned result in SAM format.
My sequence is a single end read and therefore I would expect the bitwise flag (second field) in the SAM format contains only 0, 4, 16 (correct me if i m wrong).
However, I notice one aligned result with strange value:
id1 20 chrX 154913749 25 36M * 0 0 TGCGGTCCAACCCTAACCCTAACCCTAACCCTAACC SVVVVV[[[[[[[[[[Z[Z[[[[ZZ[[[[[Z[[[[Z XT:A:U NM:i:2X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:2T4T28
I cannot explain why there is a bitwise flag 20 in the second field. I expect it to come from 4+16, however, since it is mapped in reverse strand (give 16), then why there is 4 (which means unmapped) contribute to the bitwise flag?
Thank you very much for the help.
Comment