SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Is it a bug in BWA? SD2010Bioinfo Bioinformatics 4 10-11-2012 06:27 PM
is it bug in cufflinks? jay2008 Bioinformatics 0 10-10-2012 03:16 PM
tophat bug MeixiaZhao Bioinformatics 5 04-26-2012 02:14 PM
A samtools v0.1.11 bug??? nturay Bioinformatics 0 04-28-2011 03:52 AM
TopHat bug telos Bioinformatics 0 03-17-2010 08:50 AM

Reply
 
Thread Tools
Old 12-20-2013, 01:31 AM   #1
zslee
Member
 
Location: shanghai of china

Join Date: May 2009
Posts: 29
Default Possible picard bug

Hey, I am running picard to remove pcr-duplicates using MarkDuplicates.jar
on bam file porduce by tophat(with fusion-serach on), and I encount:
Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once.

I extract the problematic alignment from the bam, I get:
HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 24288534 50 71M chr10 112724798 0 TAATGATTGTACTTGATATTAAGTGTTCTCAACGGAGTAACTTTTAAGTGGAAACCAAGTTTAGATTTGGG *++++++++'+)+++++++++++++)+++))+++)++**()++++++++++++*++++*****(((((&&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:1 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 99 chr1 118320545 50 29M chr10 112724798 0 AAGTTGCACTGATACTACCATTATATCAC +)))&')**(***(((((('&&'''('&& AS:i:-3 XM:i:1 XO:i:0 XG:i:0 MD:Z:37A62 NM:i:1 XF:Z:2 chr1-chr1 24288604 71m118320545F29M CCCAAATCTAAACTTGGTTTCCACTTAAAAGTTACTCCGTTGAGAACACTTAATATCAAGTACAATCATTAAAGTTGCACTGATACTACCATTATATCAC &&&(((((*****++++*++++++++++++)(**++)+++))+++)+++++++++++++)+'++++++++*+)))&')**(***(((((('&&'''('&& XP:Z:chr10 112724798 22M35353N78M NH:i:1
HISEQ700708:110:C0TKRACXX:7:1301:12779:136004 147 chr10 112724798 50 22M35353N78M chr1 24288604 0 TGACAACTACCTGCTGAAATTGGAAACCTGTCCAGTTTAAGTCGTCTTGGTCTGAGATATAACAGACTGTCAGCAATACCCAGATCATTAGCAAAATGCA &&&&"!$#!&'''''''%'('&&****(++*)')++')++(+*'+)++))*'&'+)+++**)*')*+++++*+++)*&++++*++++**))*(((((&&& XA:i:2 MD:Z:0A0A98 NM:i:2 XS:A:+ XP:Z:chr1-chr1 24288604 71m118320544F29M NH:i:1

yes, one end reported twice because of splited alignment, so, how to deal with this? or it is a bug ?

thanks for any discussion in advance.
zslee is offline   Reply With Quote
Old 01-08-2014, 01:00 AM   #2
TiborNagy
Senior Member
 
Location: Budapest

Join Date: Mar 2010
Posts: 329
Default

Replace the read ids with unique values.
TiborNagy is offline   Reply With Quote
Reply

Tags
bug, picard, remove duplicates

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:53 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO